Transcript: Human XM_017001131.1

PREDICTED: Homo sapiens BMP/retinoic acid inducible neural specific 3 (BRINP3), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRINP3 (339479)
Length:
3232
CDS:
1455..2876

Additional Resources:

NCBI RefSeq record:
XM_017001131.1
NBCI Gene record:
BRINP3 (339479)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153811 CCTTAGCAAGAGGTGTCATAA pLKO.1 1709 CDS 100% 13.200 18.480 N BRINP3 n/a
2 TRCN0000152416 CACACATGAACTTGCTGACAA pLKO.1 3018 3UTR 100% 4.950 3.960 N BRINP3 n/a
3 TRCN0000157749 CGGAGACTTCACCACATTCAA pLKO.1 1152 5UTR 100% 5.625 3.938 N BRINP3 n/a
4 TRCN0000153297 GCAGGGATTTAGCACAAGATA pLKO.1 709 5UTR 100% 5.625 3.938 N BRINP3 n/a
5 TRCN0000154095 CCCAATGGTAATGAGAGCATT pLKO.1 2487 CDS 100% 4.950 3.465 N BRINP3 n/a
6 TRCN0000151524 CGAATAACTGAAACCTGGAAA pLKO.1 1488 CDS 100% 4.950 3.465 N BRINP3 n/a
7 TRCN0000157935 CTTCGGAGACTTCACCACATT pLKO.1 1149 5UTR 100% 4.950 3.465 N BRINP3 n/a
8 TRCN0000156817 GAAGCAATTCGGGACCTGATT pLKO.1 2607 CDS 100% 4.950 3.465 N BRINP3 n/a
9 TRCN0000156973 GAGTGGATAGCACTGAGTCTT pLKO.1 560 5UTR 100% 4.950 3.465 N BRINP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05461 pDONR223 100% 61.7% 61.7% None 0_1ins879 n/a
2 TRCN0000477767 TTCCTAGCGATTTCTCAATACATG pLX_317 17% 61.7% 61.7% V5 0_1ins879 n/a
Download CSV