Transcript: Human XM_017001188.1

PREDICTED: Homo sapiens regulator of G protein signaling like 1 (RGSL1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RGSL1 (353299)
Length:
3994
CDS:
31..3357

Additional Resources:

NCBI RefSeq record:
XM_017001188.1
NBCI Gene record:
RGSL1 (353299)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036872 CCCTTGTAAAGCGTCGTATAT pLKO.1 2717 CDS 100% 13.200 18.480 N RGSL1 n/a
2 TRCN0000036871 CCCTCCTAAATCTACGGACAA pLKO.1 3138 CDS 100% 4.050 5.670 N RGSL1 n/a
3 TRCN0000036870 CGGGCATATAATGAGAATGAT pLKO.1 2848 CDS 100% 5.625 4.500 N RGSL1 n/a
4 TRCN0000036841 CCGATTACCTTTCTTCTGTAA pLKO.1 243 CDS 100% 4.950 3.960 N RGSL1 n/a
5 TRCN0000036840 CCTCAAGAGAAGGTGGTTATA pLKO.1 985 CDS 100% 13.200 9.240 N RGSL1 n/a
6 TRCN0000036843 GCCAGAAATACCTTGTAACTT pLKO.1 180 CDS 100% 5.625 3.938 N RGSL1 n/a
7 TRCN0000036873 GCCATCAATGAGACCCAGAAA pLKO.1 2049 CDS 100% 4.950 3.465 N RGSL1 n/a
8 TRCN0000036869 GCAGAGATAAATCATCTCTTA pLKO.1 3527 3UTR 100% 0.495 0.347 N RGSL1 n/a
9 TRCN0000036842 CCCTCTGAACATGAGCATCAA pLKO.1 825 CDS 100% 4.950 2.970 N RGSL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14482 pDONR223 100% 47.5% 47.1% None (many diffs) n/a
2 ccsbBroad304_14482 pLX_304 0% 47.5% 47.1% V5 (many diffs) n/a
3 TRCN0000467301 CACCGTCATCACTCAATCAATTTC pLX_317 25.7% 47.5% 47.1% V5 (many diffs) n/a
Download CSV