Transcript: Human XM_017001193.2

PREDICTED: Homo sapiens regulator of G protein signaling like 1 (RGSL1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RGSL1 (353299)
Length:
3979
CDS:
199..3495

Additional Resources:

NCBI RefSeq record:
XM_017001193.2
NBCI Gene record:
RGSL1 (353299)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036872 CCCTTGTAAAGCGTCGTATAT pLKO.1 2846 CDS 100% 13.200 18.480 N RGSL1 n/a
2 TRCN0000036871 CCCTCCTAAATCTACGGACAA pLKO.1 3267 CDS 100% 4.050 5.670 N RGSL1 n/a
3 TRCN0000036870 CGGGCATATAATGAGAATGAT pLKO.1 2977 CDS 100% 5.625 4.500 N RGSL1 n/a
4 TRCN0000036841 CCGATTACCTTTCTTCTGTAA pLKO.1 372 CDS 100% 4.950 3.960 N RGSL1 n/a
5 TRCN0000036840 CCTCAAGAGAAGGTGGTTATA pLKO.1 1114 CDS 100% 13.200 9.240 N RGSL1 n/a
6 TRCN0000036843 GCCAGAAATACCTTGTAACTT pLKO.1 309 CDS 100% 5.625 3.938 N RGSL1 n/a
7 TRCN0000036873 GCCATCAATGAGACCCAGAAA pLKO.1 2178 CDS 100% 4.950 3.465 N RGSL1 n/a
8 TRCN0000036869 GCAGAGATAAATCATCTCTTA pLKO.1 3512 3UTR 100% 0.495 0.347 N RGSL1 n/a
9 TRCN0000036842 CCCTCTGAACATGAGCATCAA pLKO.1 954 CDS 100% 4.950 2.970 N RGSL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14482 pDONR223 100% 48.6% 48.5% None 1_1689del;2045G>T;2113A>G n/a
2 ccsbBroad304_14482 pLX_304 0% 48.6% 48.5% V5 1_1689del;2045G>T;2113A>G n/a
3 TRCN0000467301 CACCGTCATCACTCAATCAATTTC pLX_317 25.7% 48.6% 48.5% V5 1_1689del;2045G>T;2113A>G n/a
Download CSV