Transcript: Human XM_017001307.2

PREDICTED: Homo sapiens microtubule affinity regulating kinase 1 (MARK1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MARK1 (4139)
Length:
4645
CDS:
868..2880

Additional Resources:

NCBI RefSeq record:
XM_017001307.2
NBCI Gene record:
MARK1 (4139)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001307.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262887 ATTTCGAGAAGTACGAATAAT pLKO_005 849 5UTR 100% 15.000 21.000 N MARK1 n/a
2 TRCN0000199037 CGACGCAGCGTTGCTTATAAT pLKO.1 2401 CDS 100% 15.000 21.000 N MARK1 n/a
3 TRCN0000262889 GTCACACTGCCAACCATTAAA pLKO_005 2227 CDS 100% 15.000 21.000 N MARK1 n/a
4 TRCN0000024173 CTGGGACATCTATTGCCTTTA pLKO.1 2819 CDS 100% 10.800 15.120 N Mark1 n/a
5 TRCN0000262890 TTACGAGGGAAGTACCGTATT pLKO_005 1345 CDS 100% 10.800 15.120 N MARK1 n/a
6 TRCN0000006331 GCGGTTCACATGGAGTATGAA pLKO.1 2592 CDS 100% 5.625 7.875 N MARK1 n/a
7 TRCN0000006332 CCTGCTGTATCATATACCAAA pLKO.1 1831 CDS 100% 4.950 6.930 N MARK1 n/a
8 TRCN0000006330 GCAGCACAACAGTTGGATCAA pLKO.1 1922 CDS 100% 4.950 6.930 N MARK1 n/a
9 TRCN0000006328 CCCATGTAGAATTTGCCCTTA pLKO.1 2980 3UTR 100% 4.050 5.670 N MARK1 n/a
10 TRCN0000362163 CTTAATGCAATAAGGTTATAC pLKO_005 2997 3UTR 100% 13.200 10.560 N Mark1 n/a
11 TRCN0000262888 CACTTCTGGTCATCCTATTAA pLKO_005 2205 CDS 100% 15.000 10.500 N MARK1 n/a
12 TRCN0000196818 GAACGTCAACTGGTATAATAA pLKO.1 2477 CDS 100% 15.000 10.500 N MARK1 n/a
13 TRCN0000196780 GATGAAGTTATGGCTACTTAT pLKO.1 1612 CDS 100% 13.200 9.240 N MARK1 n/a
14 TRCN0000194906 CATTGGAAATTACCGTTTACA pLKO.1 705 5UTR 100% 5.625 3.938 N MARK1 n/a
15 TRCN0000006329 GCACGAGATGAAATAAATGAT pLKO.1 1570 CDS 100% 5.625 3.938 N MARK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001307.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.