Transcript: Human XM_017001380.2

PREDICTED: Homo sapiens nuclear VCP like (NVL), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NVL (4931)
Length:
3018
CDS:
53..2722

Additional Resources:

NCBI RefSeq record:
XM_017001380.2
NBCI Gene record:
NVL (4931)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001380.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101446 CCTAGTTATTGGAGCTACTAA pLKO.1 1447 CDS 100% 5.625 7.875 N Nvl n/a
2 TRCN0000162771 CCTGCTGTCTTTATATCGGAA pLKO.1 520 CDS 100% 2.640 3.696 N NVL n/a
3 TRCN0000285517 CTAGTTATTGGAGCTACTAAT pLKO_005 1448 CDS 100% 0.000 0.000 N NVL n/a
4 TRCN0000276292 CAAATGAGTCCGGACTAAATT pLKO_005 2142 CDS 100% 15.000 10.500 N NVL n/a
5 TRCN0000165716 CCAGATCCACAGTCAGCAAAT pLKO.1 485 CDS 100% 10.800 7.560 N NVL n/a
6 TRCN0000164083 CTAATGTGACATGGGCAGATA pLKO.1 1962 CDS 100% 4.950 3.465 N NVL n/a
7 TRCN0000165441 GCAGCAATGTGTGCAGTCAAT pLKO.1 1676 CDS 100% 4.950 3.465 N NVL n/a
8 TRCN0000276287 GCAGCAATGTGTGCAGTCAAT pLKO_005 1676 CDS 100% 4.950 3.465 N NVL n/a
9 TRCN0000166804 CCAGACCAGTTCAAAGCTCTT pLKO.1 2045 CDS 100% 4.050 2.835 N NVL n/a
10 TRCN0000158870 GCTAAAGAATAAAGGAAGCAA pLKO.1 820 CDS 100% 3.000 2.100 N NVL n/a
11 TRCN0000276291 CCACTAACAGGCCAGATATAA pLKO_005 2403 CDS 100% 15.000 9.000 N NVL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001380.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11006 pDONR223 100% 67.9% 66.9% None (many diffs) n/a
2 ccsbBroad304_11006 pLX_304 0% 67.9% 66.9% V5 (many diffs) n/a
Download CSV