Transcript: Human XM_017001395.2

PREDICTED: Homo sapiens PBX homeobox 1 (PBX1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PBX1 (5087)
Length:
3164
CDS:
464..1684

Additional Resources:

NCBI RefSeq record:
XM_017001395.2
NBCI Gene record:
PBX1 (5087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012576 GCGGAAGAGACGGAATTTCAA pLKO.1 1165 CDS 100% 5.625 7.875 N Pbx1 n/a
2 TRCN0000240254 TTCAAGAGGAAGCCAATATTT pLKO_005 1356 CDS 100% 15.000 10.500 N LOC676870 n/a
3 TRCN0000274085 TTCAAGAGGAAGCCAATATTT pLKO_005 1356 CDS 100% 15.000 10.500 N PBX1 n/a
4 TRCN0000320979 ACTCTCACAGATCAGACAAAT pLKO_005 922 CDS 100% 13.200 9.240 N Pbx1 n/a
5 TRCN0000020393 CATGTCAAACTCTGGAGATTT pLKO.1 1480 CDS 100% 13.200 9.240 N PBX1 n/a
6 TRCN0000274138 CATGTCAAACTCTGGAGATTT pLKO_005 1480 CDS 100% 13.200 9.240 N PBX1 n/a
7 TRCN0000240257 GGATACCCTTCGCCATGTTAT pLKO_005 1576 CDS 100% 13.200 9.240 N LOC676870 n/a
8 TRCN0000240256 ACAGTCTCCCAGGTATCAAAC pLKO_005 1289 CDS 100% 10.800 7.560 N LOC676870 n/a
9 TRCN0000274137 ATGATCCTGCGTTCCCGATTT pLKO_005 1133 CDS 100% 10.800 7.560 N PBX1 n/a
10 TRCN0000012577 CTCACAGATCAGACAAATCTA pLKO.1 925 CDS 100% 5.625 3.938 N Pbx1 n/a
11 TRCN0000012575 GCCTGCCTTGTTTAATGTGTT pLKO.1 685 CDS 100% 4.950 3.465 N Pbx1 n/a
12 TRCN0000321049 GCCTGCCTTGTTTAATGTGTT pLKO_005 685 CDS 100% 4.950 3.465 N Pbx1 n/a
13 TRCN0000020392 GCAAGCGACAGAAATCCTGAA pLKO.1 1189 CDS 100% 4.050 2.835 N PBX1 n/a
14 TRCN0000012574 GCCAATATTTATGCTGCCAAA pLKO.1 1367 CDS 100% 4.050 2.835 N Pbx1 n/a
15 TRCN0000020390 GCCTTGTTTAATGTGTTGTGT pLKO.1 689 CDS 100% 3.000 2.100 N PBX1 n/a
16 TRCN0000321052 TCAAGAGGAAGCCAATATTTA pLKO_005 1357 CDS 100% 15.000 9.000 N Pbx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.