Transcript: Human XM_017001721.1

PREDICTED: Homo sapiens NECAP endocytosis associated 2 (NECAP2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NECAP2 (55707)
Length:
1863
CDS:
39..596

Additional Resources:

NCBI RefSeq record:
XM_017001721.1
NBCI Gene record:
NECAP2 (55707)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165698 CGGGCATGTTTGGCAGTAAAT pLKO.1 820 3UTR 100% 13.200 18.480 N NECAP2 n/a
2 TRCN0000275234 CGGGCATGTTTGGCAGTAAAT pLKO_005 820 3UTR 100% 13.200 18.480 N NECAP2 n/a
3 TRCN0000275240 GACGGGCGTTTATTGGAATTG pLKO_005 340 CDS 100% 10.800 15.120 N NECAP2 n/a
4 TRCN0000275233 ACGGATTCCAGCAGGTACTTC pLKO_005 291 CDS 100% 4.950 6.930 N NECAP2 n/a
5 TRCN0000165062 GATCCGCATCGAAGATGGAAA pLKO.1 314 CDS 100% 4.950 3.960 N NECAP2 n/a
6 TRCN0000161268 GATGCCTTTGACTTCAATGTT pLKO.1 378 CDS 100% 5.625 3.938 N NECAP2 n/a
7 TRCN0000275235 CCAAATCTACAGGATCAACTT pLKO_005 614 3UTR 100% 4.950 3.465 N NECAP2 n/a
8 TRCN0000166462 CCAGACCATCAAGCTCAACAT pLKO.1 503 CDS 100% 4.950 3.465 N NECAP2 n/a
9 TRCN0000166290 CAATGTTGCATTGCAGGACCA pLKO.1 392 CDS 100% 2.160 1.512 N NECAP2 n/a
10 TRCN0000163018 GACCATTTCAAGTGGGTGAAA pLKO.1 408 CDS 100% 0.495 0.297 N NECAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03634 pDONR223 100% 70% 60.8% None (many diffs) n/a
2 ccsbBroad304_03634 pLX_304 0% 70% 60.8% V5 (many diffs) n/a
3 TRCN0000478327 GTCCGCCCACGATCCGTCAGTCTC pLX_317 48.9% 70% 60.8% V5 (many diffs) n/a
Download CSV