Construct: ORF TRCN0000478327
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001890.2_s317c1
- Derived from:
- ccsbBroadEn_03634
- DNA Barcode:
- GTCCGCCCACGATCCGTCAGTCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NECAP2 (55707)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478327
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55707 | NECAP2 | NECAP endocytosis associated 2 | NM_018090.5 | 100% | 100% | |
| 2 | human | 55707 | NECAP2 | NECAP endocytosis associated 2 | NM_001145278.1 | 90.1% | 90.1% | 13_14ins78 |
| 3 | human | 55707 | NECAP2 | NECAP endocytosis associated 2 | NM_001145277.1 | 79.6% | 84.7% | 666_667ins76;714_819del |
| 4 | human | 55707 | NECAP2 | NECAP endocytosis associated 2 | XM_017001721.1 | 70% | 60.8% | (many diffs) |
| 5 | human | 55707 | NECAP2 | NECAP endocytosis associated 2 | XM_011541767.2 | 61.8% | 65.5% | 0_1ins159;507_508ins76;555_660del |
| 6 | human | 55707 | NECAP2 | NECAP endocytosis associated 2 | XR_001737295.1 | 36.9% | 1_38del;528_644del;945_2135del | |
| 7 | human | 55707 | NECAP2 | NECAP endocytosis associated 2 | XR_001737296.1 | 33.3% | (many diffs) | |
| 8 | human | 55707 | NECAP2 | NECAP endocytosis associated 2 | XR_002957108.1 | 25.8% | 1_38del;528_1567del;1868_3058del | |
| 9 | human | 55707 | NECAP2 | NECAP endocytosis associated 2 | XR_002957109.1 | 23.3% | (many diffs) | |
| 10 | mouse | 66147 | Necap2 | NECAP endocytosis associated 2 | NM_025383.3 | 85.3% | 88.3% | (many diffs) |
| 11 | mouse | 66147 | Necap2 | NECAP endocytosis associated 2 | XR_001784179.1 | 65.2% | (many diffs) | |
| 12 | mouse | 66147 | Necap2 | NECAP endocytosis associated 2 | XR_390777.3 | 61.4% | (many diffs) | |
| 13 | mouse | 66147 | Necap2 | NECAP endocytosis associated 2 | XR_881436.1 | 60.3% | (many diffs) | |
| 14 | mouse | 66147 | Necap2 | NECAP endocytosis associated 2 | XR_001784177.1 | 33.7% | (many diffs) | |
| 15 | mouse | 66147 | Necap2 | NECAP endocytosis associated 2 | XR_001784178.1 | 23.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 855
- ORF length:
- 789
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggagagcggg tacgagtcgg tgctctgtgt caagcctgac gtccacgtct 121 accgcatccc tccgcgggct accaaccgtg gctacagggc tgcggagtgg cagctggacc 181 agccatcatg gagtggccgg ctgaggatca ctgcaaaggg acagatggcc tacatcaagc 241 tggaggacag gacgtcaggg gagctctttg ctcaggcccc ggtggatcag tttcctggca 301 cagctgtgga gagtgtgacg gattccagca ggtacttcgt gatccgcatc gaagatggaa 361 atgggcgacg ggcgtttatt ggaattggct tcggggaccg aggtgatgcc tttgacttca 421 atgttgcatt gcaggaccat ttcaagtggg tgaaacagca gtgtgaattT GCAAAACAAG 481 CCCAGAACCC AGACCAAGGC CCTAAACTGG ACCTGGGCTT CAAGGAGGGC CAGACCATCA 541 AGCTCAACAT CGCAAACATG AAGAAGAAGG AAGGAGCAGC TGGGAATCCC CGAGTCCGGC 601 CTGCCAGCAC AGGAGGGCTG AGCCTGCTTC CCCCTCCCCC AGGGGGGAAA ACCTCCACCC 661 TGATCCCTCC CCCTGGGGAG CAGTTGGCTG TGGGGGGATC CCTCGTCCAG CCAGCAGTTG 721 CTCCCAGTTC AGGAGGTGCT CCTGTACCCT GGCCACAGCC CAATCCTGCC ACTGCTGACA 781 TCTGGGGAGA CTTTACCAAA TCTACAGGAT CAACTTCCAG CCAGACCCAG CCAGGCACAG 841 GCTGGGTCCA GTTCTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 901 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 961 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GTCCGCCCAC GATCCGTCAG 1021 TCTCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt