Transcript: Human XM_017001722.2

PREDICTED: Homo sapiens chromosome 1 open reading frame 112 (C1orf112), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C1orf112 (55732)
Length:
2663
CDS:
99..2663

Additional Resources:

NCBI RefSeq record:
XM_017001722.2
NBCI Gene record:
C1orf112 (55732)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001722.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163284 GCTTCCTGACTATGTTCGTTT pLKO.1 2252 CDS 100% 4.950 6.930 N C1orf112 n/a
2 TRCN0000412754 AGACCACTCTAAGGAATATTT pLKO_005 418 CDS 100% 15.000 12.000 N C1orf112 n/a
3 TRCN0000435113 ATGCTGTACTTAGTGCTAATA pLKO_005 1603 CDS 100% 13.200 9.240 N C1orf112 n/a
4 TRCN0000162058 GACCCTTTAGTAGATGACAAT pLKO.1 705 CDS 100% 4.950 3.465 N C1orf112 n/a
5 TRCN0000165153 GCTGCTCACATTTCAGCCTTT pLKO.1 1220 CDS 100% 4.050 2.835 N C1orf112 n/a
6 TRCN0000161934 GCTGGAGTTTATCCAGAAATT pLKO.1 1811 CDS 100% 1.320 0.924 N C1orf112 n/a
7 TRCN0000160729 CGCTAAGGAATTTCTTCCTTT pLKO.1 1049 CDS 100% 0.495 0.347 N C1orf112 n/a
8 TRCN0000163102 GTCACCTTGTATCAGCATGTT pLKO.1 1509 CDS 100% 4.950 2.970 N C1orf112 n/a
9 TRCN0000165342 GCAAGTTTCCTCCAAGCCTTT pLKO.1 1120 CDS 100% 4.050 2.430 N C1orf112 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001722.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12262 pDONR223 100% 51.3% 51.5% None (many diffs) n/a
2 ccsbBroad304_12262 pLX_304 0% 51.3% 51.5% V5 (many diffs) n/a
3 TRCN0000472066 GTACAATCACTATCATTTAATACT pLX_317 4% 51.3% 51.5% V5 (many diffs) n/a
Download CSV