Transcript: Human XM_017001840.2

PREDICTED: Homo sapiens formin 2 (FMN2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FMN2 (56776)
Length:
4659
CDS:
339..3647

Additional Resources:

NCBI RefSeq record:
XM_017001840.2
NBCI Gene record:
FMN2 (56776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365566 TTCGTATTATCTCCGAAATTT pLKO_005 3095 CDS 100% 15.000 21.000 N FMN2 n/a
2 TRCN0000365635 TTTGGAGACCACGGCATATTT pLKO_005 3392 CDS 100% 15.000 21.000 N FMN2 n/a
3 TRCN0000365563 TGAGTCATTGCAACGACTTTC pLKO_005 3670 3UTR 100% 10.800 8.640 N FMN2 n/a
4 TRCN0000370715 CTGTTGTGAACTTGGATAATT pLKO_005 2632 CDS 100% 15.000 10.500 N FMN2 n/a
5 TRCN0000123004 GCTCTCCATAACTATGTATTT pLKO.1 4171 3UTR 100% 13.200 9.240 N FMN2 n/a
6 TRCN0000365565 TTGTGTCTCCAAGGCGAATAT pLKO_005 841 CDS 100% 13.200 9.240 N FMN2 n/a
7 TRCN0000377603 TGAATTGTTTGTATCAGTTTC pLKO_005 4077 3UTR 100% 10.800 7.560 N FMN2 n/a
8 TRCN0000123006 CCAGGATTCAACTACATAGTA pLKO.1 2374 CDS 100% 5.625 3.938 N FMN2 n/a
9 TRCN0000123008 GCTAAACAAGTTGTCAAGTTA pLKO.1 2535 CDS 100% 5.625 3.938 N FMN2 n/a
10 TRCN0000123005 CCATTCTATTTCTACCGAGTT pLKO.1 968 CDS 100% 4.050 2.835 N FMN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.