Transcript: Human XM_017001858.1

PREDICTED: Homo sapiens Rh family B glycoprotein (gene/pseudogene) (RHBG), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHBG (57127)
Length:
1366
CDS:
48..1292

Additional Resources:

NCBI RefSeq record:
XM_017001858.1
NBCI Gene record:
RHBG (57127)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059419 CGTCTACCATTCAGACCTCTT pLKO.1 689 CDS 100% 4.050 5.670 N RHBG n/a
2 TRCN0000059420 GTACAAGTTCTTCACGCCCAT pLKO.1 1010 CDS 100% 2.160 3.024 N RHBG n/a
3 TRCN0000059418 GCTGTTTGTCACACTGATGTT pLKO.1 1235 CDS 100% 4.950 3.465 N RHBG n/a
4 TRCN0000059421 GAGCATGATCAATGCTGACTT pLKO.1 419 CDS 100% 0.495 0.347 N RHBG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14225 pDONR223 100% 71.7% 71.5% None (many diffs) n/a
2 ccsbBroad304_14225 pLX_304 0% 71.7% 71.5% V5 (many diffs) n/a
3 TRCN0000480931 TACAAAACACCTACGCGAAAATAC pLX_317 33.3% 71.7% 71.5% V5 (many diffs) n/a
Download CSV