Transcript: Human XM_017001938.1

PREDICTED: Homo sapiens coiled-coil domain containing 181 (CCDC181), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC181 (57821)
Length:
3848
CDS:
2142..3671

Additional Resources:

NCBI RefSeq record:
XM_017001938.1
NBCI Gene record:
CCDC181 (57821)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134539 GCTAAGCGTTCTAAACAGTTA pLKO.1 3591 CDS 100% 4.950 6.930 N CCDC181 n/a
2 TRCN0000137508 GACTAGAAGCTAAGCGTTCTA pLKO.1 3583 CDS 100% 0.495 0.693 N CCDC181 n/a
3 TRCN0000133911 CCCATATCAGATTCAGATAGT pLKO.1 2421 CDS 100% 4.950 3.465 N CCDC181 n/a
4 TRCN0000133960 CTCACCAAGAAGAAATGACAT pLKO.1 2369 CDS 100% 4.950 3.465 N CCDC181 n/a
5 TRCN0000137056 CTCCACTAGAAGACACTACTA pLKO.1 2632 CDS 100% 4.950 3.465 N CCDC181 n/a
6 TRCN0000136588 CCAGGTATTCAACCTTTGGAT pLKO.1 2400 CDS 100% 3.000 2.100 N CCDC181 n/a
7 TRCN0000137134 CCAGCATAATAGAGATGGCTT pLKO.1 2245 CDS 100% 2.640 1.848 N CCDC181 n/a
8 TRCN0000134230 GTTTGGGAAACTGTCACAATT pLKO.1 2687 CDS 100% 13.200 7.920 N CCDC181 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12407 pDONR223 100% 72.9% 72.5% None 515T>C;1099_1100insA;1116_1527del n/a
2 ccsbBroad304_12407 pLX_304 0% 72.9% 72.5% V5 515T>C;1099_1100insA;1116_1527del n/a
3 TRCN0000470623 TCCTTAACCTAGCATTCGGAACTG pLX_317 39.7% 72.9% 72.5% V5 515T>C;1099_1100insA;1116_1527del n/a
Download CSV