Transcript: Human XM_017002480.1

PREDICTED: Homo sapiens BCAR3 adaptor protein, NSP family member (BCAR3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCAR3 (8412)
Length:
3595
CDS:
666..3143

Additional Resources:

NCBI RefSeq record:
XM_017002480.1
NBCI Gene record:
BCAR3 (8412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376434 ATGCCGCTTGTGACGTTAATG pLKO_005 2796 CDS 100% 13.200 18.480 N BCAR3 n/a
2 TRCN0000364816 TAACTGCCCTCTCGCGTAAAT pLKO_005 3088 CDS 100% 13.200 18.480 N BCAR3 n/a
3 TRCN0000369755 ATTAAGGTAACTACTGCTAAT pLKO_005 3355 3UTR 100% 10.800 15.120 N BCAR3 n/a
4 TRCN0000364878 CCAGAAACATGCCGGTGAATC pLKO_005 694 CDS 100% 10.800 15.120 N BCAR3 n/a
5 TRCN0000369682 GCGCCTGGACATAATTGAAAG pLKO_005 2447 CDS 100% 10.800 15.120 N BCAR3 n/a
6 TRCN0000072994 GCCCAACGAGTTTGAGTCAAA pLKO.1 2213 CDS 100% 4.950 6.930 N BCAR3 n/a
7 TRCN0000072993 GCCTATCAAGATGTGTCTATA pLKO.1 786 CDS 100% 13.200 10.560 N BCAR3 n/a
8 TRCN0000364815 TAGTATCCACAGGATATTAAA pLKO_005 3259 3UTR 100% 15.000 10.500 N BCAR3 n/a
9 TRCN0000369683 CTGGACCCAACTGTGGAATAT pLKO_005 996 CDS 100% 13.200 9.240 N BCAR3 n/a
10 TRCN0000376503 TCGGCATTGCAGTGGACATTC pLKO_005 2485 CDS 100% 10.800 7.560 N BCAR3 n/a
11 TRCN0000072997 CCTGGAAACAGCAATGTTGAA pLKO.1 2258 CDS 100% 4.950 3.465 N BCAR3 n/a
12 TRCN0000072995 CGAGATGGTGACTTCCTAGTT pLKO.1 1173 CDS 100% 4.950 3.465 N BCAR3 n/a
13 TRCN0000072996 GACTGAATTTCAAATGCGATT pLKO.1 3002 CDS 100% 4.050 2.430 N BCAR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01924 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01924 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468731 TGCGAACAGACTGACTAACACAGG pLX_317 16.5% 100% 100% V5 n/a
Download CSV