Transcript: Human XM_017002551.2

PREDICTED: Homo sapiens transcription termination factor 2 (TTF2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTF2 (8458)
Length:
8819
CDS:
22..3594

Additional Resources:

NCBI RefSeq record:
XM_017002551.2
NBCI Gene record:
TTF2 (8458)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022230 GCTCGAATCATATTGGATGAA pLKO.1 2299 CDS 100% 4.950 6.930 N TTF2 n/a
2 TRCN0000022232 CCTGACAATGATTGCGCTCAT pLKO.1 1851 CDS 100% 4.050 5.670 N TTF2 n/a
3 TRCN0000419750 TCAAGCTTGTGACCGAATTTA pLKO_005 3393 CDS 100% 15.000 10.500 N TTF2 n/a
4 TRCN0000438202 TGCCTCCCTGATCCATCATTG pLKO_005 1989 CDS 100% 10.800 7.560 N TTF2 n/a
5 TRCN0000022233 CGTGTCTACCTTACAACACAA pLKO.1 1261 CDS 100% 4.950 3.465 N TTF2 n/a
6 TRCN0000022229 GCCCTAATAATCCATTCAGTA pLKO.1 2753 CDS 100% 4.950 3.465 N TTF2 n/a
7 TRCN0000022231 CCCGAATAAAGGAAAGAGCTT pLKO.1 87 CDS 100% 2.640 1.848 N TTF2 n/a
8 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 6819 3UTR 100% 4.950 2.475 Y ERN2 n/a
9 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 6819 3UTR 100% 4.950 2.475 Y P3H4 n/a
10 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 6819 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000128227 CAGGAGAATCACTTGAATCTA pLKO.1 6988 3UTR 100% 5.625 2.813 Y NLRP8 n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5223 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11275 pDONR223 100% 54.9% 53.1% None (many diffs) n/a
2 ccsbBroad304_11275 pLX_304 0% 54.9% 53.1% V5 (many diffs) n/a
Download CSV