Transcript: Human XM_017002755.1

PREDICTED: Homo sapiens LIM homeobox 4 (LHX4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LHX4 (89884)
Length:
6160
CDS:
810..1757

Additional Resources:

NCBI RefSeq record:
XM_017002755.1
NBCI Gene record:
LHX4 (89884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419923 ATGGAAGTCCTCCGCTGATTC pLKO_005 1875 3UTR 100% 10.800 15.120 N LHX4 n/a
2 TRCN0000413112 GTGTAGGCTATCCCGACTTTC pLKO_005 1687 CDS 100% 10.800 15.120 N LHX4 n/a
3 TRCN0000017490 GCAGTTCTATAAGAGCGTCAA pLKO.1 1259 CDS 100% 4.050 3.240 N LHX4 n/a
4 TRCN0000017489 GACAGTAATTTGGGCATCATT pLKO.1 1587 CDS 100% 5.625 3.938 N LHX4 n/a
5 TRCN0000070554 CTTTGCTCAATGGGCTGGATT pLKO.1 1558 CDS 100% 4.950 3.465 N Lhx4 n/a
6 TRCN0000017491 GAGGATCAAATTCTCTCAGAA pLKO.1 1362 CDS 100% 4.950 3.465 N LHX4 n/a
7 TRCN0000017492 GCACTGCTTTGCTTGCATCAT pLKO.1 920 CDS 100% 4.950 3.465 N LHX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04496 pDONR223 100% 79.8% 78.9% None (many diffs) n/a
2 ccsbBroad304_04496 pLX_304 0% 79.8% 78.9% V5 (many diffs) n/a
3 TRCN0000478681 CCCAAGCTATTCGCCCATCTAACG pLX_317 36.3% 79.8% 78.9% V5 (many diffs) n/a
Download CSV