Transcript: Human XM_017002852.1

PREDICTED: Homo sapiens RAS protein activator like 2 (RASAL2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RASAL2 (9462)
Length:
12851
CDS:
2982..7211

Additional Resources:

NCBI RefSeq record:
XM_017002852.1
NBCI Gene record:
RASAL2 (9462)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414673 AGTGTGACTGGTCGCCAATTT pLKO_005 4578 CDS 100% 13.200 18.480 N RASAL2 n/a
2 TRCN0000427135 ATCTCGGACTCTAACTCTTAT pLKO_005 5321 CDS 100% 13.200 18.480 N RASAL2 n/a
3 TRCN0000238018 TGACTAATCCTACGCCAATAC pLKO_005 5638 CDS 100% 10.800 15.120 N Rasal2 n/a
4 TRCN0000238019 AGGACCTTCTATTCGGATTAA pLKO_005 4652 CDS 100% 13.200 10.560 N Rasal2 n/a
5 TRCN0000001405 GCCTTCCACCTCTTCATAGTA pLKO.1 4471 CDS 100% 5.625 4.500 N RASAL2 n/a
6 TRCN0000001404 CCCTCGTGTTCTTGCTGATAT pLKO.1 5606 CDS 100% 13.200 9.240 N RASAL2 n/a
7 TRCN0000435386 GCTTTGAGGTTACCTACTTAA pLKO_005 4189 CDS 100% 13.200 9.240 N RASAL2 n/a
8 TRCN0000434530 TTCTTCGTTTATGGATCATTG pLKO_005 4321 CDS 100% 10.800 7.560 N RASAL2 n/a
9 TRCN0000001406 CCTACGCCAATACAACAGCAA pLKO.1 5646 CDS 100% 2.640 1.848 N RASAL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.