Transcript: Human XM_017002883.2

PREDICTED: Homo sapiens phosphodiesterase 4D interacting protein (PDE4DIP), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDE4DIP (9659)
Length:
8672
CDS:
408..7745

Additional Resources:

NCBI RefSeq record:
XM_017002883.2
NBCI Gene record:
PDE4DIP (9659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07462 pDONR223 100% 46.2% 46.2% None 3396_7335delinsA n/a
2 ccsbBroad304_07462 pLX_304 0% 46.2% 46.2% V5 3396_7335delinsA n/a
3 TRCN0000473671 ATACATCCAACTTCAGTAGTATCG pLX_317 9.4% 46.2% 46.2% V5 3396_7335delinsA n/a
Download CSV