Transcript: Human XM_017002980.2

PREDICTED: Homo sapiens ubiquitin associated protein 2 like (UBAP2L), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBAP2L (9898)
Length:
3936
CDS:
124..3384

Additional Resources:

NCBI RefSeq record:
XM_017002980.2
NBCI Gene record:
UBAP2L (9898)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002980.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272687 TGTTGCCTAATCCGTATATTA pLKO_005 2516 CDS 100% 15.000 21.000 N UBAP2L n/a
2 TRCN0000007677 CCCACCCTGTTGTATGTATTA pLKO.1 3551 3UTR 100% 13.200 18.480 N UBAP2L n/a
3 TRCN0000007679 CCGCCACAAGTATATGGTTAT pLKO.1 2563 CDS 100% 10.800 15.120 N UBAP2L n/a
4 TRCN0000217173 CAGATGATTTCGGACCATAAT pLKO.1 241 CDS 100% 13.200 10.560 N Ubap2l n/a
5 TRCN0000241398 CAGATGATTTCGGACCATAAT pLKO_005 241 CDS 100% 13.200 10.560 N Ubap2l n/a
6 TRCN0000272739 CAGATGATTTCGGACCATAAT pLKO_005 241 CDS 100% 13.200 10.560 N UBAP2L n/a
7 TRCN0000272686 GCCCTAAGTCTCCTTCTTTAT pLKO_005 3745 3UTR 100% 13.200 9.240 N UBAP2L n/a
8 TRCN0000007681 CGCAGCAGAATACCCTTTCAT pLKO.1 2219 CDS 100% 5.625 3.938 N UBAP2L n/a
9 TRCN0000284801 CGCAGCAGAATACCCTTTCAT pLKO_005 2219 CDS 100% 5.625 3.938 N UBAP2L n/a
10 TRCN0000007680 GCCAATACTGATGATAACTAT pLKO.1 745 CDS 100% 5.625 3.938 N UBAP2L n/a
11 TRCN0000284803 GCCAATACTGATGATAACTAT pLKO_005 745 CDS 100% 5.625 3.938 N UBAP2L n/a
12 TRCN0000007678 GCCCTCTTTATGAACAGAGAT pLKO.1 1889 CDS 100% 4.950 3.465 N UBAP2L n/a
13 TRCN0000241396 ACACGGGCGTGCCAGATATAT pLKO_005 3047 CDS 100% 15.000 10.500 N Ubap2l n/a
14 TRCN0000217827 CAGATATCTCAGGGCTAAATC pLKO.1 1649 CDS 100% 13.200 9.240 N Ubap2l n/a
15 TRCN0000241397 CAGATATCTCAGGGCTAAATC pLKO_005 1649 CDS 100% 13.200 9.240 N Ubap2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002980.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07506 pDONR223 100% 99.8% 99.8% None 1446G>C;2967_2968insCAG n/a
2 ccsbBroad304_07506 pLX_304 0% 99.8% 99.8% V5 1446G>C;2967_2968insCAG n/a
3 TRCN0000472263 TTGACGGGTTGTACTTTACCACAA pLX_317 11.8% 99.8% 99.8% V5 1446G>C;2967_2968insCAG n/a
Download CSV