Transcript: Human XM_017002996.1

PREDICTED: Homo sapiens RAB GTPase activating protein 1 like (RABGAP1L), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RABGAP1L (9910)
Length:
6425
CDS:
192..1118

Additional Resources:

NCBI RefSeq record:
XM_017002996.1
NBCI Gene record:
RABGAP1L (9910)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002996.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002996.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15682 pDONR223 0% 21.9% 22% None 205_205delAinsTTTGTATATTT;207_924del n/a
2 ccsbBroad304_15682 pLX_304 0% 21.9% 22% V5 205_205delAinsTTTGTATATTT;207_924del n/a
3 TRCN0000473968 AATATCTGTCGGCCTTAAACCATG pLX_317 100% 21.8% 21.7% V5 6G>A;205_205delAinsTTTGTATATTT;207_924del n/a
Download CSV