Transcript: Human XM_017003116.1

PREDICTED: Homo sapiens actin related protein 1B (ACTR1B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACTR1B (10120)
Length:
2281
CDS:
395..1393

Additional Resources:

NCBI RefSeq record:
XM_017003116.1
NBCI Gene record:
ACTR1B (10120)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003116.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116308 CCGATTACTCAGTGAAGTGAA pLKO.1 1198 CDS 100% 4.950 6.930 N ACTR1B n/a
2 TRCN0000315660 CCGATTACTCAGTGAAGTGAA pLKO_005 1198 CDS 100% 4.950 6.930 N ACTR1B n/a
3 TRCN0000116310 TCCCGTGCTATTCATCGCAAA pLKO.1 1364 CDS 100% 4.050 5.670 N ACTR1B n/a
4 TRCN0000315727 TCCCGTGCTATTCATCGCAAA pLKO_005 1364 CDS 100% 4.050 5.670 N ACTR1B n/a
5 TRCN0000116311 AGGAGACCAGATTCCCAAATA pLKO.1 340 5UTR 100% 13.200 9.240 N ACTR1B n/a
6 TRCN0000315659 AGGAGACCAGATTCCCAAATA pLKO_005 340 5UTR 100% 13.200 9.240 N ACTR1B n/a
7 TRCN0000116309 CAGTACGTCTACTCCAAGGAT pLKO.1 533 CDS 100% 3.000 2.100 N ACTR1B n/a
8 TRCN0000349130 CAGTACGTCTACTCCAAGGAT pLKO_005 533 CDS 100% 3.000 2.100 N ACTR1B n/a
9 TRCN0000116307 GCCACTTAATAAGGAGTCAGA pLKO.1 2099 3UTR 100% 2.640 1.848 N ACTR1B n/a
10 TRCN0000315728 GCCACTTAATAAGGAGTCAGA pLKO_005 2099 3UTR 100% 2.640 1.848 N ACTR1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003116.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07555 pDONR223 100% 88.2% 88.2% None 0_1ins132;672C>G n/a
2 ccsbBroad304_07555 pLX_304 0% 88.2% 88.2% V5 0_1ins132;672C>G n/a
3 TRCN0000465969 GCCACCGGCCCCGTCGATTCAGTA pLX_317 38.1% 88.2% 88.2% V5 0_1ins132;672C>G n/a
4 ccsbBroadEn_07554 pDONR223 100% 88.1% 88% None 0_1ins132;146T>C;672C>G n/a
5 ccsbBroad304_07554 pLX_304 0% 88.1% 88% V5 0_1ins132;146T>C;672C>G n/a
6 TRCN0000471351 ATAATAAATACATTTACAGATCGA pLX_317 45.1% 88.1% 88% V5 0_1ins132;146T>C;672C>G n/a
Download CSV