Transcript: Human XM_017003262.1

PREDICTED: Homo sapiens polypeptide N-acetylgalactosaminyltransferase 13 (GALNT13), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GALNT13 (114805)
Length:
1932
CDS:
391..1533

Additional Resources:

NCBI RefSeq record:
XM_017003262.1
NBCI Gene record:
GALNT13 (114805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003262.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425841 GAAGAACGCTCTGGGTTAATA pLKO_005 394 CDS 100% 15.000 21.000 N GALNT13 n/a
2 TRCN0000414831 ACTCACGTTGCGACATGTTAA pLKO_005 1548 3UTR 100% 13.200 18.480 N GALNT13 n/a
3 TRCN0000417381 TTACGATGCAGGAATGGATAT pLKO_005 768 CDS 100% 10.800 15.120 N GALNT13 n/a
4 TRCN0000035396 GCCAGTGATTTGATTGCCCTT pLKO.1 7 5UTR 100% 2.160 3.024 N GALNT13 n/a
5 TRCN0000035394 GCCCTATCATTGATGTGATTA pLKO.1 548 CDS 100% 13.200 10.560 N GALNT13 n/a
6 TRCN0000433073 ATGGACCTGTAATCATGTTAA pLKO_005 1310 CDS 100% 13.200 9.240 N GALNT13 n/a
7 TRCN0000035398 CCAGGTGTTGTCAAAGTGGAT pLKO.1 1000 CDS 100% 2.640 1.848 N GALNT13 n/a
8 TRCN0000035397 GCTGCTAAGGAACATGACCTT pLKO.1 1656 3UTR 100% 2.640 1.848 N GALNT13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003262.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13039 pDONR223 100% 67.7% 67.7% None 0_1ins543 n/a
2 ccsbBroad304_13039 pLX_304 0% 67.7% 67.7% V5 0_1ins543 n/a
Download CSV