Transcript: Human XM_017003270.1

PREDICTED: Homo sapiens oxysterol binding protein like 6 (OSBPL6), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OSBPL6 (114880)
Length:
7035
CDS:
699..3410

Additional Resources:

NCBI RefSeq record:
XM_017003270.1
NBCI Gene record:
OSBPL6 (114880)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160736 CACCACTTGCATACACAACAT pLKO.1 2792 CDS 100% 4.950 6.930 N OSBPL6 n/a
2 TRCN0000161875 GCCAACAAACTATGAGCTGTA pLKO.1 3059 CDS 100% 4.050 3.240 N OSBPL6 n/a
3 TRCN0000159097 GCTGCAACCATATTCCTTAAA pLKO.1 3606 3UTR 100% 13.200 9.240 N OSBPL6 n/a
4 TRCN0000160612 CCAACATATCACATTCTGAAT pLKO.1 3430 3UTR 100% 4.950 3.465 N OSBPL6 n/a
5 TRCN0000105099 GCACAGAAAGTGCATTCTCTT pLKO.1 1749 CDS 100% 4.950 3.465 N Osbpl6 n/a
6 TRCN0000161853 GCATCAGAGAAGCAAAGAGTA pLKO.1 3210 CDS 100% 4.950 3.465 N OSBPL6 n/a
7 TRCN0000159956 GCCAACATATCACATTCTGAA pLKO.1 3429 3UTR 100% 4.950 3.465 N OSBPL6 n/a
8 TRCN0000160194 CAGACAATATTTCTCGGCAAA pLKO.1 2206 CDS 100% 4.050 2.835 N OSBPL6 n/a
9 TRCN0000160955 GCAGACAATATTTCTCGGCAA pLKO.1 2205 CDS 100% 2.160 1.512 N OSBPL6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13041 pDONR223 100% 54.6% 52.3% None (many diffs) n/a
2 ccsbBroad304_13041 pLX_304 0% 54.6% 52.3% V5 (many diffs) n/a
3 TRCN0000467518 TAACCGGAATGGGGTTTTACGCCT pLX_317 14.1% 54.6% 52.3% V5 (many diffs) n/a
Download CSV