Transcript: Human XM_017003289.1

PREDICTED: Homo sapiens par-3 family cell polarity regulator beta (PARD3B), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PARD3B (117583)
Length:
7621
CDS:
156..3272

Additional Resources:

NCBI RefSeq record:
XM_017003289.1
NBCI Gene record:
PARD3B (117583)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419266 GTAACCACCTCTAGGCGAAAT pLKO_005 1503 CDS 100% 10.800 15.120 N PARD3B n/a
2 TRCN0000429082 TACATGGTCCCGGTCCCATTT pLKO_005 865 CDS 100% 10.800 15.120 N PARD3B n/a
3 TRCN0000117963 CGCCAAGAACTAAGGACACAT pLKO.1 223 CDS 100% 4.950 6.930 N PARD3B n/a
4 TRCN0000432738 GGTGGATTCAGCAGTATATTT pLKO_005 1685 CDS 100% 15.000 12.000 N PARD3B n/a
5 TRCN0000424230 TGTACAGACAGAACTACTAAC pLKO_005 200 CDS 100% 10.800 8.640 N PARD3B n/a
6 TRCN0000117966 CCAACCACGAAGCTATGGAAA pLKO.1 1339 CDS 100% 4.950 3.465 N PARD3B n/a
7 TRCN0000117964 CCATGCTTTGAGAACTGTCAA pLKO.1 1476 CDS 100% 4.950 3.465 N PARD3B n/a
8 TRCN0000117962 GCGTGAAAGGATTGGAGCAAA pLKO.1 2387 CDS 100% 4.950 3.465 N PARD3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.