Transcript: Human XM_017003405.2

PREDICTED: Homo sapiens catenin alpha 2 (CTNNA2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTNNA2 (1496)
Length:
3316
CDS:
213..2843

Additional Resources:

NCBI RefSeq record:
XM_017003405.2
NBCI Gene record:
CTNNA2 (1496)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003405.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420427 TACACGGCCTCTCAAGCATTT pLKO_005 873 CDS 100% 10.800 15.120 N CTNNA2 n/a
2 TRCN0000437769 TGACCCTTGCTCGTCGGTAAA pLKO_005 548 CDS 100% 10.800 15.120 N CTNNA2 n/a
3 TRCN0000147074 CAACCGAGATTATGTGTTCAA pLKO.1 926 CDS 100% 4.950 6.930 N CTNNA2 n/a
4 TRCN0000148903 CCAGAAGAACTAGAGGATGAT pLKO.1 2109 CDS 100% 4.950 3.465 N CTNNA2 n/a
5 TRCN0000147992 GAGGTAGATTGTGATGTCATA pLKO.1 2676 CDS 100% 4.950 3.465 N CTNNA2 n/a
6 TRCN0000150270 GAAACCAATGTTCCTTTGCTA pLKO.1 1392 CDS 100% 3.000 2.100 N CTNNA2 n/a
7 TRCN0000149367 GCTACAAATGAGCAAGACCTT pLKO.1 708 CDS 100% 2.640 1.848 N CTNNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003405.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06063 pDONR223 100% 92.9% 89.6% None (many diffs) n/a
2 ccsbBroad304_06063 pLX_304 0% 92.9% 89.6% V5 (many diffs) n/a
Download CSV