Transcript: Human XM_017003656.1

PREDICTED: Homo sapiens SATB homeobox 2 (SATB2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SATB2 (23314)
Length:
4958
CDS:
223..2250

Additional Resources:

NCBI RefSeq record:
XM_017003656.1
NBCI Gene record:
SATB2 (23314)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020686 CTGCCGAAATTGACCAGAGAT pLKO.1 2228 CDS 100% 4.950 3.465 N SATB2 n/a
2 TRCN0000020685 GCCATGCAGAATTTCCTCAAT pLKO.1 1297 CDS 100% 4.950 3.465 N SATB2 n/a
3 TRCN0000020687 GCCTTAAAGGAACTGCTCAAA pLKO.1 580 CDS 100% 4.950 3.465 N SATB2 n/a
4 TRCN0000020684 GCCATTTATGACGAGATCCAA pLKO.1 1504 CDS 100% 3.000 2.100 N SATB2 n/a
5 TRCN0000020688 CGACATGCTACAAGATGTCTA pLKO.1 468 CDS 100% 0.495 0.347 N SATB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02751 pDONR223 100% 92% 92% None 0_1ins174 n/a
2 ccsbBroad304_02751 pLX_304 0% 92% 92% V5 0_1ins174 n/a
3 TRCN0000468644 GTGCTTGGTGTGTATATTGGTGTA pLX_317 17.8% 92% 92% V5 0_1ins174 n/a
Download CSV