Transcript: Human XM_017003755.1

PREDICTED: Homo sapiens cilia and flagella associated protein 65 (CFAP65), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFAP65 (255101)
Length:
7516
CDS:
1798..7425

Additional Resources:

NCBI RefSeq record:
XM_017003755.1
NBCI Gene record:
CFAP65 (255101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154042 CGGCAGATTTATGAGCTGTAT pLKO.1 5554 CDS 100% 4.950 6.930 N CFAP65 n/a
2 TRCN0000427079 TGGAATGAGCAGTCAACTAAG pLKO_005 6778 CDS 100% 10.800 8.640 N CFAP65 n/a
3 TRCN0000153970 CGACTACTTTCTGGCTAACTT pLKO.1 6471 CDS 100% 5.625 4.500 N CFAP65 n/a
4 TRCN0000250335 CGGCAACTGCACCCTCTATTA pLKO_005 4659 CDS 100% 13.200 9.240 N Cfap65 n/a
5 TRCN0000154072 CCTCAACAACATCTCCAAGAA pLKO.1 5985 CDS 100% 4.950 3.465 N CFAP65 n/a
6 TRCN0000158264 CCTGCTGGAAGACAAGAACTT pLKO.1 6702 CDS 100% 4.950 3.465 N CFAP65 n/a
7 TRCN0000152736 CAGCCTGTACTTAATGCCAAT pLKO.1 6816 CDS 100% 4.050 2.835 N CFAP65 n/a
8 TRCN0000158071 CTTTGGGAATGTGCTGGTGAA pLKO.1 4602 CDS 100% 4.050 2.835 N CFAP65 n/a
9 TRCN0000153853 CCTGTACTTAATGCCAATCCT pLKO.1 6819 CDS 100% 3.000 2.100 N CFAP65 n/a
10 TRCN0000157716 CCTGGTCAACAAAGACTGCAA pLKO.1 3999 CDS 100% 2.640 1.848 N CFAP65 n/a
11 TRCN0000419125 GGCAACTGCACCCTCTATTAC pLKO_005 4660 CDS 100% 13.200 7.920 N CFAP65 n/a
12 TRCN0000165520 GAGGAGGAAGAAGAGGAGAAA pLKO.1 6982 CDS 100% 4.950 2.475 Y AP5B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14451 pDONR223 100% 7.1% 6.4% None (many diffs) n/a
2 ccsbBroad304_14451 pLX_304 0% 7.1% 6.4% V5 (many diffs) n/a
3 TRCN0000472983 CTCAAAAAATGCACATTCAGGTCC pLX_317 79.1% 7.1% 6.4% V5 (many diffs) n/a
Download CSV