Transcript: Human XM_017003801.1

PREDICTED: Homo sapiens glutamine--fructose-6-phosphate transaminase 1 (GFPT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GFPT1 (2673)
Length:
6918
CDS:
73..2247

Additional Resources:

NCBI RefSeq record:
XM_017003801.1
NBCI Gene record:
GFPT1 (2673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003801.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075222 CCTCTGGCTTTGGTGGATAAA pLKO.1 1936 CDS 100% 13.200 9.240 N GFPT1 n/a
2 TRCN0000333026 CCTCTGGCTTTGGTGGATAAA pLKO_005 1936 CDS 100% 13.200 9.240 N GFPT1 n/a
3 TRCN0000075221 CCAGTTTGTATCCCTTGTGAT pLKO.1 1641 CDS 100% 4.950 3.465 N GFPT1 n/a
4 TRCN0000075218 GCTGCTTTGGACAACTGACAA pLKO.1 2950 3UTR 100% 4.950 3.465 N GFPT1 n/a
5 TRCN0000363668 GCTGCTTTGGACAACTGACAA pLKO_005 2950 3UTR 100% 4.950 3.465 N GFPT1 n/a
6 TRCN0000075220 GCAGATACTTTGATGGGTCTT pLKO.1 1480 CDS 100% 4.050 2.835 N GFPT1 n/a
7 TRCN0000333025 GCAGATACTTTGATGGGTCTT pLKO_005 1480 CDS 100% 4.050 2.835 N GFPT1 n/a
8 TRCN0000075219 CGTCTTTCTATCCATCGAATT pLKO.1 1063 CDS 100% 0.000 0.000 N GFPT1 n/a
9 TRCN0000363728 CGTCTTTCTATCCATCGAATT pLKO_005 1063 CDS 100% 0.000 0.000 N GFPT1 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4482 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4482 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000295386 AGATCATGAAGGGCAACTTTA pLKO_005 1145 CDS 100% 13.200 9.240 N Gfpt1 n/a
13 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4480 3UTR 100% 4.950 2.475 Y ERN2 n/a
14 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4480 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4480 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 4647 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003801.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.