Transcript: Human XM_017003895.1

PREDICTED: Homo sapiens RUN and FYVE domain containing 4 (RUFY4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RUFY4 (285180)
Length:
3840
CDS:
1593..3311

Additional Resources:

NCBI RefSeq record:
XM_017003895.1
NBCI Gene record:
RUFY4 (285180)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437858 CTTCAGGGACACGCAACAAAG pLKO_005 2724 CDS 100% 10.800 15.120 N RUFY4 n/a
2 TRCN0000428319 TGCTGCAGTTTGACCAGAAAG pLKO_005 1741 CDS 100% 10.800 7.560 N RUFY4 n/a
3 TRCN0000129467 GAGATCAAGAGCCTCAGACTT pLKO.1 2835 CDS 100% 4.950 3.465 N RUFY4 n/a
4 TRCN0000129798 CATGGATTACAAGAAGAGAGA pLKO.1 3242 CDS 100% 2.640 1.848 N RUFY4 n/a
5 TRCN0000128024 GCAACAAAGGCATCTTCCTTT pLKO.1 2315 CDS 100% 0.495 0.347 N RUFY4 n/a
6 TRCN0000130783 GTTGGAACTGATCCAAGAGAA pLKO.1 3083 CDS 100% 0.495 0.347 N RUFY4 n/a
7 TRCN0000129566 GTGGAGAATCCACAAGTGCAA pLKO.1 2757 CDS 100% 2.640 1.584 N RUFY4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13542 pDONR223 100% 69.5% 69.5% None 1_522del n/a
2 ccsbBroad304_13542 pLX_304 0% 69.5% 69.5% V5 1_522del n/a
3 TRCN0000480504 TGCCGGTCCTGTCCGCCCCTCTCG pLX_317 34.3% 69.5% 69.5% V5 1_522del n/a
Download CSV