Transcript: Human XM_017004005.1

PREDICTED: Homo sapiens integrin subunit alpha 6 (ITGA6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITGA6 (3655)
Length:
5231
CDS:
273..3206

Additional Resources:

NCBI RefSeq record:
XM_017004005.1
NBCI Gene record:
ITGA6 (3655)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057776 CAGGGTAATAAACTTAGGTAA pLKO.1 2432 CDS 100% 4.950 6.930 N ITGA6 n/a
2 TRCN0000057775 CGGATCGAGTTTGATAACGAT pLKO.1 216 5UTR 100% 3.000 2.400 N ITGA6 n/a
3 TRCN0000289094 CGGATCGAGTTTGATAACGAT pLKO_005 216 5UTR 100% 3.000 2.400 N ITGA6 n/a
4 TRCN0000296162 TTCTTTAACTGCCGTAATTTA pLKO_005 3418 3UTR 100% 15.000 10.500 N ITGA6 n/a
5 TRCN0000057773 CCTCTCAGATTCAGTAACTAT pLKO.1 1292 CDS 100% 5.625 3.938 N ITGA6 n/a
6 TRCN0000057774 CGAGAAGGAAATCAAGACAAA pLKO.1 1863 CDS 100% 4.950 3.465 N ITGA6 n/a
7 TRCN0000289039 CGAGAAGGAAATCAAGACAAA pLKO_005 1863 CDS 100% 4.950 3.465 N ITGA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06457 pDONR223 100% 85.8% 85.4% None (many diffs) n/a
2 TRCN0000479977 TGGTCTTCCTACACCCCTGGCGGG pLX_317 10.8% 85.8% 85.4% V5 (many diffs) n/a
Download CSV