Transcript: Human XM_017004366.1

PREDICTED: Homo sapiens syntrophin gamma 2 (SNTG2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNTG2 (54221)
Length:
2653
CDS:
90..1400

Additional Resources:

NCBI RefSeq record:
XM_017004366.1
NBCI Gene record:
SNTG2 (54221)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004366.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243238 ACGAAAGAGGTGCTGACAATT pLKO_005 234 CDS 100% 13.200 18.480 N SNTG2 n/a
2 TRCN0000180547 GCTCGCATCTCAAGGTACAAA pLKO.1 771 CDS 100% 5.625 7.875 N SNTG2 n/a
3 TRCN0000243240 CGGCTTGGGCCTGAGTATAAA pLKO_005 338 CDS 100% 15.000 12.000 N SNTG2 n/a
4 TRCN0000180621 GCATTTCTGAAGCTCCCGTTA pLKO.1 570 CDS 100% 4.050 3.240 N SNTG2 n/a
5 TRCN0000243242 ACAACGTCCCTGTCGTCATAT pLKO_005 373 CDS 100% 13.200 9.240 N SNTG2 n/a
6 TRCN0000243241 CTCGCATCTCAAGGTACAAAG pLKO_005 772 CDS 100% 10.800 7.560 N SNTG2 n/a
7 TRCN0000243239 TTACCATCACCGTTGAGTATC pLKO_005 535 CDS 100% 10.800 7.560 N SNTG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004366.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12034 pDONR223 100% 53.4% 51.6% None (many diffs) n/a
2 ccsbBroad304_12034 pLX_304 0% 53.4% 51.6% V5 (many diffs) n/a
3 TRCN0000471988 ATCCACCCTGGGGACTCACCTCAG pLX_317 9.6% 53.4% 51.6% V5 (many diffs) n/a
Download CSV