Transcript: Human XM_017004447.1

PREDICTED: Homo sapiens dedicator of cytokinesis 10 (DOCK10), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOCK10 (55619)
Length:
7506
CDS:
227..6820

Additional Resources:

NCBI RefSeq record:
XM_017004447.1
NBCI Gene record:
DOCK10 (55619)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435855 ATGATCCGATAACGAATATTG pLKO_005 1506 CDS 100% 13.200 18.480 N DOCK10 n/a
2 TRCN0000427025 TAAGACCTTGTGCCAGTATAA pLKO_005 3529 CDS 100% 13.200 18.480 N DOCK10 n/a
3 TRCN0000429906 TACGACATTCATCGGTCATAT pLKO_005 5798 CDS 100% 13.200 18.480 N DOCK10 n/a
4 TRCN0000437058 ACCGTTACTGTTCGGTCATTC pLKO_005 863 CDS 100% 10.800 15.120 N DOCK10 n/a
5 TRCN0000122953 CTAAGCGTATAAGGACTGTTT pLKO.1 5211 CDS 100% 4.950 6.930 N DOCK10 n/a
6 TRCN0000122950 CCCAAACTCTTACAGATGTTA pLKO.1 4595 CDS 100% 5.625 4.500 N DOCK10 n/a
7 TRCN0000122951 CCAGGATTCCAACAAGGTAAA pLKO.1 6025 CDS 100% 10.800 7.560 N DOCK10 n/a
8 TRCN0000122083 CAATCCAAGTACCAATGAGAA pLKO.1 4123 CDS 100% 4.950 3.465 N DOCK10 n/a
9 TRCN0000122949 CCAGTGAATGTGTAGCTCAAA pLKO.1 7103 3UTR 100% 4.950 3.465 N DOCK10 n/a
10 TRCN0000122952 CCTCTGTGGATCATTCTGTTA pLKO.1 4915 CDS 100% 4.950 3.465 N DOCK10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12236 pDONR223 100% 23.6% 23.2% None 1_4944del;6456_6531del;6591_6592ins55 n/a
2 ccsbBroad304_12236 pLX_304 0% 23.6% 23.2% V5 1_4944del;6456_6531del;6591_6592ins55 n/a
3 TRCN0000473559 AACGGTCTGATACTATGCAAGGTC pLX_317 26.1% 23.6% 23.2% V5 1_4944del;6456_6531del;6591_6592ins55 n/a
Download CSV