Transcript: Human XM_017004619.1

PREDICTED: Homo sapiens NLR family CARD domain containing 4 (NLRC4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NLRC4 (58484)
Length:
2713
CDS:
262..2628

Additional Resources:

NCBI RefSeq record:
XM_017004619.1
NBCI Gene record:
NLRC4 (58484)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162759 CACAATCAGGAAGCAGACATT pLKO.1 936 CDS 100% 4.950 6.930 N NLRC4 n/a
2 TRCN0000160000 CGGACATTACATCCACTTATA pLKO.1 1703 CDS 100% 13.200 10.560 N NLRC4 n/a
3 TRCN0000158998 GAACCTTACAAAGCTCATAAT pLKO.1 2550 CDS 100% 13.200 10.560 N NLRC4 n/a
4 TRCN0000162758 CAGAAATCGAAGCCCTGATAA pLKO.1 1037 CDS 100% 13.200 9.240 N NLRC4 n/a
5 TRCN0000159999 CAAAGGTTCAAGCCAAAGTAT pLKO.1 1558 CDS 100% 5.625 3.938 N NLRC4 n/a
6 TRCN0000160665 CGCGAAGAAGTAAACATCATT pLKO.1 364 CDS 100% 5.625 3.938 N NLRC4 n/a
7 TRCN0000162275 CGGGATTTCAGCAAGTTGAAT pLKO.1 2260 CDS 100% 5.625 3.938 N NLRC4 n/a
8 TRCN0000160076 CCATACCTTCTATGATCTGTT pLKO.1 1350 CDS 100% 4.950 3.465 N NLRC4 n/a
9 TRCN0000160604 CCCTTATTCAAAGAATGGGAA pLKO.1 290 CDS 100% 2.640 1.848 N NLRC4 n/a
10 TRCN0000136382 CACCTGTAATTCCAGCACTTT pLKO.1 2664 3UTR 100% 4.950 2.475 Y CENPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08776 pDONR223 100% 76.5% 76.3% None (many diffs) n/a
2 ccsbBroad304_08776 pLX_304 0% 76.5% 76.3% V5 (many diffs) n/a
3 TRCN0000467727 CCCCTAATATCAATCCCCCCGCTC pLX_317 12.8% 76.5% 76.3% V5 (many diffs) n/a
Download CSV