Transcript: Human XM_017004717.1

PREDICTED: Homo sapiens COP9 signalosome subunit 7B (COPS7B), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COPS7B (64708)
Length:
2528
CDS:
452..925

Additional Resources:

NCBI RefSeq record:
XM_017004717.1
NBCI Gene record:
COPS7B (64708)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118152 CCTGTTGGTACTGTTCCAGAA pLKO.1 1056 3UTR 100% 4.050 5.670 N COPS7B n/a
2 TRCN0000118155 CCTTATCATTGAGGCTGTCTA pLKO.1 520 CDS 100% 4.950 3.465 N COPS7B n/a
3 TRCN0000118156 GCTCTCATAAGCCAGGTCTTA pLKO.1 291 5UTR 100% 4.950 3.465 N COPS7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12478 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12478 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467104 CGGTGCTGTTCTCGTATACTCTGA pLX_317 59.6% 100% 100% V5 n/a
Download CSV