Transcript: Human XM_017004740.2

PREDICTED: Homo sapiens RANBP2 like and GRIP domain containing 3 (RGPD3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RGPD3 (653489)
Length:
3138
CDS:
31..2748

Additional Resources:

NCBI RefSeq record:
XM_017004740.2
NBCI Gene record:
RGPD3 (653489)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004740.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364583 ATACCAGCCACTTACAATTAA pLKO_005 1511 CDS 100% 15.000 7.500 Y RGPD4 n/a
2 TRCN0000364658 ATGGGTCAGCATGGTAATAAT pLKO_005 931 CDS 100% 15.000 7.500 Y RGPD4 n/a
3 TRCN0000337207 CAGGCGTTCAGTGGAATTAAA pLKO_005 279 CDS 100% 15.000 7.500 Y RGPD3 n/a
4 TRCN0000435814 CCAGGAAGTCCTGCAATTTAT pLKO_005 406 CDS 100% 15.000 7.500 Y RGPD5 n/a
5 TRCN0000017740 CCCAGGAAGTCCTGCAATTTA pLKO.1 405 CDS 100% 15.000 7.500 Y RGPD4 n/a
6 TRCN0000256741 AGAAGCAGCACATCGTCATTT pLKO_005 2634 CDS 100% 13.200 6.600 Y RGPD6 n/a
7 TRCN0000337210 AGTCAACGAGAGGATTCTATT pLKO_005 104 CDS 100% 13.200 6.600 Y RGPD3 n/a
8 TRCN0000337140 CAAGAAGTAAAGGCCATTAAG pLKO_005 2479 CDS 100% 13.200 6.600 Y RGPD3 n/a
9 TRCN0000337141 TTAGATGACAGTGATTCAAAT pLKO_005 2197 CDS 100% 13.200 6.600 Y RGPD3 n/a
10 TRCN0000262421 CTACACCATCTCCTACCAAAT pLKO_005 2366 CDS 100% 10.800 5.400 Y RGPD2 n/a
11 TRCN0000163545 GCCAAGAAGTAAAGGCCATTA pLKO.1 2477 CDS 100% 10.800 5.400 Y RGPD1 n/a
12 TRCN0000369388 TTACTGCTGGCCTATGCTAAT pLKO_005 733 CDS 100% 10.800 5.400 Y RGPD4 n/a
13 TRCN0000017742 GATTGCAGAATTGCTTTGTAA pLKO.1 327 CDS 100% 5.625 2.813 Y RGPD4 n/a
14 TRCN0000017738 CGTTCAAGTTTAGAGTGGAAT pLKO.1 622 CDS 100% 4.950 2.475 Y RGPD4 n/a
15 TRCN0000152360 CGTTCAAGTTTAGAGTGGAAT pLKO.1 622 CDS 100% 4.950 2.475 Y RGPD5 n/a
16 TRCN0000162173 CGTTCAAGTTTAGAGTGGAAT pLKO.1 622 CDS 100% 4.950 2.475 Y RGPD1 n/a
17 TRCN0000158488 CCACTTACAATTAAAGGAGAA pLKO.1 1518 CDS 100% 4.050 2.025 Y RGPD1 n/a
18 TRCN0000017741 CGTGTGTTGTACAGACCCTTA pLKO.1 644 CDS 100% 4.050 2.025 Y RGPD4 n/a
19 TRCN0000165640 GCTCACAGATTTCTGGGTCTT pLKO.1 214 CDS 100% 4.050 2.025 Y RGPD1 n/a
20 TRCN0000017739 CCGTTGAATGTTACAGGCGTT pLKO.1 266 CDS 100% 2.160 1.080 Y RGPD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004740.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.