Transcript: Human XM_017004787.2

PREDICTED: Homo sapiens GC-rich sequence DNA-binding factor 2 (GCFC2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GCFC2 (6936)
Length:
1492
CDS:
110..1384

Additional Resources:

NCBI RefSeq record:
XM_017004787.2
NBCI Gene record:
GCFC2 (6936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415085 CATCAAATCAAGCTCTAAATT pLKO_005 1071 CDS 100% 15.000 10.500 N GCFC2 n/a
2 TRCN0000015089 CCATTTCATTTCCGCCAGTAA pLKO.1 912 CDS 100% 4.950 3.465 N GCFC2 n/a
3 TRCN0000015092 CCATTTACTCTAAGACCTCAA pLKO.1 701 CDS 100% 4.050 2.430 N GCFC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11177 pDONR223 100% 49.1% 48.8% None (many diffs) n/a
2 ccsbBroad304_11177 pLX_304 0% 49.1% 48.8% V5 (many diffs) n/a
3 TRCN0000472247 TCTGCTGGTTAATAACCCAGGCCC pLX_317 77.8% 49.1% 48.8% V5 (many diffs) n/a
Download CSV