Transcript: Human XM_017005027.1

PREDICTED: Homo sapiens solute carrier family 35 member F5 (SLC35F5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC35F5 (80255)
Length:
4716
CDS:
212..1822

Additional Resources:

NCBI RefSeq record:
XM_017005027.1
NBCI Gene record:
SLC35F5 (80255)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005027.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043867 CTGAACTTACTTCGTATGTTT pLKO.1 471 CDS 100% 5.625 7.875 N SLC35F5 n/a
2 TRCN0000043863 CGCATGTCATATCCTGTGAAA pLKO.1 860 CDS 100% 4.950 6.930 N SLC35F5 n/a
3 TRCN0000043865 GCACACTTGCACTAAGCCTTA pLKO.1 1530 CDS 100% 4.050 5.670 N SLC35F5 n/a
4 TRCN0000430427 TCGTGTGAGGTTCAGTAATAT pLKO_005 787 CDS 100% 15.000 12.000 N SLC35F5 n/a
5 TRCN0000043864 GCAGGAGCTATCCCTGTATTT pLKO.1 1616 CDS 100% 13.200 9.240 N SLC35F5 n/a
6 TRCN0000435364 CAGATGCTGAAGGTTACTTTG pLKO_005 633 CDS 100% 10.800 7.560 N SLC35F5 n/a
7 TRCN0000043866 CCTGTGAAATTCCATGATCTT pLKO.1 710 CDS 100% 4.950 3.465 N SLC35F5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005027.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09022 pDONR223 100% 97.5% 97.3% None 921_959del;1602A>C n/a
2 ccsbBroad304_09022 pLX_304 0% 97.5% 97.3% V5 921_959del;1602A>C n/a
3 TRCN0000470941 TAGCAGGATTGGTCCTCGGCACAA pLX_317 28.3% 97.5% 97.3% V5 921_959del;1602A>C n/a
Download CSV