Transcript: Human XM_017005075.2

PREDICTED: Homo sapiens ANTXR cell adhesion molecule 1 (ANTXR1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANTXR1 (84168)
Length:
1271
CDS:
146..1189

Additional Resources:

NCBI RefSeq record:
XM_017005075.2
NBCI Gene record:
ANTXR1 (84168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431985 AGAAGTCCTGCATCGAAATTC pLKO_005 795 CDS 100% 13.200 9.240 N ANTXR1 n/a
2 TRCN0000063220 CAAGGCATCATCCACTCAATT pLKO.1 770 CDS 100% 13.200 9.240 N ANTXR1 n/a
3 TRCN0000063221 GCTGCACCACTGGAATGAAAT pLKO.1 310 CDS 100% 13.200 9.240 N ANTXR1 n/a
4 TRCN0000063219 CCCACAGTTGAGAATGTCCTT pLKO.1 370 CDS 100% 2.640 1.848 N ANTXR1 n/a
5 TRCN0000416148 TCTGCAGCTTCAAGATCAATG pLKO_005 912 CDS 100% 10.800 6.480 N ANTXR1 n/a
6 TRCN0000063218 CCGAGGAACAACCTTAATGAA pLKO.1 406 CDS 100% 5.625 3.375 N ANTXR1 n/a
7 TRCN0000063222 ACACTCAATGAGAAGCCCTTT pLKO.1 941 CDS 100% 4.050 2.430 N ANTXR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04338 pDONR223 100% 94% 91.9% None (many diffs) n/a
2 ccsbBroad304_04338 pLX_304 0% 94% 91.9% V5 (many diffs) n/a
3 TRCN0000475197 CTAAAAGTAAAAATAGTAAACTGC pLX_317 57.5% 94% 91.9% V5 (many diffs) n/a
Download CSV