Transcript: Human XM_017005376.2

PREDICTED: Homo sapiens eukaryotic translation initiation factor 2 alpha kinase 3 (EIF2AK3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EIF2AK3 (9451)
Length:
4536
CDS:
879..3545

Additional Resources:

NCBI RefSeq record:
XM_017005376.2
NBCI Gene record:
EIF2AK3 (9451)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005376.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195162 CGGCAGGTCATTAGTAATTAT pLKO.1 301 5UTR 100% 15.000 21.000 N EIF2AK3 n/a
2 TRCN0000262380 GGAACGACCTGAAGCTATAAA pLKO_005 3383 CDS 100% 15.000 21.000 N EIF2AK3 n/a
3 TRCN0000262374 TTTGTCCCTGGCGGGTAAATT pLKO_005 3995 3UTR 100% 15.000 21.000 N EIF2AK3 n/a
4 TRCN0000262373 TGCATCTGCCTGGTTACTTAA pLKO_005 1211 CDS 100% 13.200 18.480 N EIF2AK3 n/a
5 TRCN0000028772 GCCACTTTGAACTTCGGTATA pLKO.1 979 CDS 100% 10.800 15.120 N Eif2ak3 n/a
6 TRCN0000321805 GCCACTTTGAACTTCGGTATA pLKO_005 979 CDS 100% 10.800 15.120 N Eif2ak3 n/a
7 TRCN0000262381 CACTTTGAACTTCGGTATATT pLKO_005 981 CDS 100% 15.000 12.000 N EIF2AK3 n/a
8 TRCN0000262379 TAGCAGCAATCCCTAATATAT pLKO_005 3829 3UTR 100% 15.000 12.000 N EIF2AK3 n/a
9 TRCN0000195610 CAGGACCTTAACTGATGTAAG pLKO.1 3278 CDS 100% 10.800 8.640 N EIF2AK3 n/a
10 TRCN0000195161 CCCAAACTGATTATAGGTAAC pLKO.1 4340 3UTR 100% 6.000 4.800 N EIF2AK3 n/a
11 TRCN0000262377 ATCATAGCAACAACGTTTATT pLKO_005 1791 CDS 100% 15.000 10.500 N EIF2AK3 n/a
12 TRCN0000262376 CTCAAATTTCCACCATTATTT pLKO_005 3303 CDS 100% 15.000 10.500 N EIF2AK3 n/a
13 TRCN0000262378 GGAAACGAGAGCCGGATTTAT pLKO_005 1010 CDS 100% 15.000 10.500 N EIF2AK3 n/a
14 TRCN0000262382 GGCAACCATTGTGCTAATAAA pLKO_005 2682 CDS 100% 15.000 10.500 N EIF2AK3 n/a
15 TRCN0000001401 CCTCAAGCCATCCAACATATT pLKO.1 3005 CDS 100% 13.200 9.240 N EIF2AK3 n/a
16 TRCN0000196610 GAAACAGCTATTCTCATAAAG pLKO.1 3187 CDS 100% 13.200 9.240 N EIF2AK3 n/a
17 TRCN0000001402 GCTTTGGAATCTGTCACTAAT pLKO.1 1431 CDS 100% 13.200 9.240 N EIF2AK3 n/a
18 TRCN0000197197 GTTGTGCTAGCAACCCTAATA pLKO.1 3552 3UTR 100% 13.200 9.240 N EIF2AK3 n/a
19 TRCN0000262375 TCAATCTTGCAGTATCCATAT pLKO_005 1602 CDS 100% 10.800 7.560 N EIF2AK3 n/a
20 TRCN0000001399 CCGTAGTAAGAAATGGATCAT pLKO.1 4228 3UTR 100% 4.950 3.465 N EIF2AK3 n/a
21 TRCN0000001400 GCACACAGATTACAGTCAGAT pLKO.1 1672 CDS 100% 4.950 3.465 N EIF2AK3 n/a
22 TRCN0000001403 CCTTGTGAGTACGTGATGGTT pLKO.1 3336 CDS 100% 3.000 2.100 N EIF2AK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005376.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489399 CGAACATATCTCTTAATTACTCTC pLX_317 9.3% 79.5% 79.4% V5 (not translated due to prior stop codon) 0_1ins684;1426G>T n/a
2 TRCN0000488883 GCACCGGTCTTAAATTCAATCTAG pLX_317 8.5% 79.5% 79.4% V5 (not translated due to prior stop codon) 0_1ins684;1426G>T n/a
3 TRCN0000492157 AAACCCTACTTTCGTCCTAATACG pLX_317 10.9% 79.4% 79.4% V5 (many diffs) n/a
4 TRCN0000491412 ACACCGATACTCGCACGTATCTCC pLX_317 10.1% 79.4% 79.4% V5 (many diffs) n/a
Download CSV