Transcript: Human XM_017005393.1

PREDICTED: Homo sapiens basic leucine zipper and W2 domains 1 (BZW1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BZW1 (9689)
Length:
2674
CDS:
1..1008

Additional Resources:

NCBI RefSeq record:
XM_017005393.1
NBCI Gene record:
BZW1 (9689)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005393.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436385 ACTTGATTACCGTCGATATGC pLKO_005 17 CDS 100% 4.950 6.930 N BZW1 n/a
2 TRCN0000148768 CAAGTTAATCAGGCGCTACAA pLKO.1 93 CDS 100% 4.950 6.930 N BZW1 n/a
3 TRCN0000148891 CCTGCCAATAAGCAAAGTGTT pLKO.1 406 CDS 100% 4.950 3.465 N BZW1 n/a
4 TRCN0000147346 GCAGAAACACTCTTTGACATT pLKO.1 36 CDS 100% 4.950 3.465 N BZW1 n/a
5 TRCN0000147660 GCCAATAAGCAAAGTGTTGAA pLKO.1 409 CDS 100% 4.950 3.465 N BZW1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005393.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11404 pDONR223 100% 79.7% 74.2% None (many diffs) n/a
2 ccsbBroad304_11404 pLX_304 0% 79.7% 74.2% V5 (many diffs) n/a
3 TRCN0000469255 GCAGAAGTTCGCACTTAGGCTCTG pLX_317 39.7% 79.7% 74.2% V5 (many diffs) n/a
Download CSV