Construct: ORF TRCN0000469255
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006329.1_s317c1
- Derived from:
- ccsbBroadEn_11404
- DNA Barcode:
- GCAGAAGTTCGCACTTAGGCTCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BZW1 (9689)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469255
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9689 | BZW1 | basic leucine zipper and W2... | NM_001207067.2 | 99.9% | 100% | 415T>C |
| 2 | human | 9689 | BZW1 | basic leucine zipper and W2... | NM_001321688.2 | 99.9% | 100% | 415T>C |
| 3 | human | 9689 | BZW1 | basic leucine zipper and W2... | NM_001321690.1 | 99.9% | 100% | 415T>C |
| 4 | human | 9689 | BZW1 | basic leucine zipper and W2... | NM_001207069.1 | 98.9% | 99% | 1_12del;427T>C |
| 5 | human | 9689 | BZW1 | basic leucine zipper and W2... | NM_001207068.3 | 92.8% | 92.9% | 1_96del;511T>C |
| 6 | human | 9689 | BZW1 | basic leucine zipper and W2... | NM_001321691.2 | 91.8% | 91.8% | 415T>C;1000_1001ins102 |
| 7 | human | 9689 | BZW1 | basic leucine zipper and W2... | NM_001321693.2 | 85.8% | 85.9% | 63_64ins177;238T>C |
| 8 | human | 9689 | BZW1 | basic leucine zipper and W2... | NM_014670.3 | 84.1% | 84.2% | 415T>C;853_854ins198 |
| 9 | human | 9689 | BZW1 | basic leucine zipper and W2... | NM_001321694.2 | 79.8% | 74.4% | 0_1ins163;81_82ins89;163T>C |
| 10 | human | 9689 | BZW1 | basic leucine zipper and W2... | XM_017005393.1 | 79.7% | 74.2% | (many diffs) |
| 11 | mouse | 66882 | Bzw1 | basic leucine zipper and W2... | NM_025824.3 | 92.6% | 100% | (many diffs) |
| 12 | mouse | 66882 | Bzw1 | basic leucine zipper and W2... | XM_006496197.3 | 86.1% | 92.9% | (many diffs) |
| 13 | mouse | 66882 | Bzw1 | basic leucine zipper and W2... | XM_017322066.1 | 73.3% | 73.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1323
- ORF length:
- 1257
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa taatcaaaag cagcaaaagc caacgctatc aggccagcgt tttaaaacta 121 gaaaaagaga tgaaaaagag aggtttgacc ctactcagtt tcaagactgt attattcaag 181 gcttaactga aaccggtact gatttggaag cagtagctaa gtttcttgat gcttctggag 241 caaaacttga ttaccgtcga tatgcagaaa cactctttga cattctggtg gctggtggaa 301 tgctggcccc aggtggtaca ctggcagatg acatgatgcg tacagatgtc tgcgtgtttg 361 cagcccaaga agatctagag accatgcaag catttgctca ggtttttaac aagttaatca 421 ggcgctacaa atacctggag aaaggttttg aagatgaagt aaaaaagctg ctgctgttcc 481 tgaagggttt ttcagagtcg gagaggaaca agctagctat gttgactggt gttcttctgg 541 ctaatggaac acttaatgca tccattctta atagccttta taatgaaaat ttggttaaag 601 aaggagtttc agcagctttt gctgtgaagc tctttaaatc atggataaat gaaaaagata 661 tcaatgcagt agctgcaagt cttcggaaag tcagcatgga taacagactg atggaactct 721 ttcctgccaa taagcaaagt gttgaacact tcacaaaata ttttactgag gcaggcttga 781 aagagctttc agaatatgtt cggaatcagc aaaccatcgg agctcGTAAG GAGCTCCAGA 841 AAGAACTTCA AGAACAGATG TCCCGTGGTG ATCCATTTAA GGATATAATT TTATATGTCA 901 AGGAGGAGAT GAAAAAAAAC AACATCCCAG AGCCAGTTGT CATCGGAATA GTCTGGTCAA 961 GTGTAATGAG CACTGTGGAA TGGAACAAAA AAGAGGAGCT TGTAGCAGAG CAAGCCATCA 1021 AGCACTTGAA GCAATACAGC CCTCTACTTG CTGCCTTTAC TACTCAAGGT CAGTCTGAGC 1081 TGACTCTGTT ACTGAAGATT CAGGAGTATT GCTATGACAA CATTCATTTC ATGAAAGCCT 1141 TCCAGAAAAT AGTGGTGCTT TTTTATAAAG CTGAAGTCCT GAGCGAGGAG CCCATTTTGA 1201 AGTGGTATAA AGATGCACAT GTTGCAAAGG GGAAGAGTGT TTTCCTTGAG CAAATGAAAA 1261 AGTTTGTAGA ATGGCTCAAA AATGCTGAAG AAGAATCTGA ATCTGAAGCT GAAGAAGGTG 1321 ACTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1381 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1441 GGCTTTATAT ATCTTGTGGA AAGGACGAGC AGAAGTTCGC ACTTAGGCTC TGACGCGTTA 1501 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt