Transcript: Human XM_017005403.2

PREDICTED: Homo sapiens ring finger protein 144A (RNF144A), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF144A (9781)
Length:
2419
CDS:
380..1129

Additional Resources:

NCBI RefSeq record:
XM_017005403.2
NBCI Gene record:
RNF144A (9781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004415 CCTTCTGATACACTACGATAA pLKO.1 1045 CDS 100% 10.800 15.120 N RNF144A n/a
2 TRCN0000421486 ATGTTGAGCTCTTGATCAAAG pLKO_005 528 CDS 100% 10.800 7.560 N RNF144A n/a
3 TRCN0000004414 CGATGATTTCCTTCTGATACA pLKO.1 1036 CDS 100% 4.950 3.465 N RNF144A n/a
4 TRCN0000004413 GAACGAGATTGAGTGCATGGT pLKO.1 613 CDS 100% 2.640 1.848 N RNF144A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07484 pDONR223 100% 85.1% 84.9% None 10A>G;747_748ins129 n/a
2 ccsbBroad304_07484 pLX_304 0% 85.1% 84.9% V5 10A>G;747_748ins129 n/a
3 TRCN0000466327 CTTCTATGCCATAGGGAACGGAGT pLX_317 43.9% 85.1% 84.9% V5 10A>G;747_748ins129 n/a
Download CSV