Transcript: Human XM_017005496.2

PREDICTED: Homo sapiens RNA binding motif protein 6 (RBM6), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBM6 (10180)
Length:
2510
CDS:
146..2455

Additional Resources:

NCBI RefSeq record:
XM_017005496.2
NBCI Gene record:
RBM6 (10180)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151373 GAAGGAGTATAACACAGGTTA pLKO.1 1612 CDS 100% 4.950 6.930 N RBM6 n/a
2 TRCN0000432533 ACGGAACACAAGTAGACTTTA pLKO_005 831 CDS 100% 13.200 10.560 N RBM6 n/a
3 TRCN0000421006 AGAACCTTGATCCGCCATTTA pLKO_005 2304 CDS 100% 13.200 10.560 N RBM6 n/a
4 TRCN0000154124 CCAGCAGGCTTATTCGATTAA pLKO.1 1506 CDS 100% 13.200 10.560 N RBM6 n/a
5 TRCN0000155013 GCACCGATCTTCCTGTTCATT pLKO.1 1798 CDS 100% 5.625 4.500 N RBM6 n/a
6 TRCN0000431588 GAATAGAGATGTATCTGATTT pLKO_005 793 CDS 100% 13.200 9.240 N RBM6 n/a
7 TRCN0000434171 GACCTTCAGGATCAAGATTAT pLKO_005 1460 CDS 100% 13.200 9.240 N RBM6 n/a
8 TRCN0000152100 CAAATGTAGAGGAGCATTCTT pLKO.1 342 CDS 100% 5.625 3.938 N RBM6 n/a
9 TRCN0000152718 CAAAGAAGTTACCCTGGAGTA pLKO.1 1723 CDS 100% 4.050 2.835 N RBM6 n/a
10 TRCN0000154391 CCAGCTGATAAGGAACCTGAA pLKO.1 1934 CDS 100% 4.050 2.835 N RBM6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07565 pDONR223 100% 21.2% 19.5% None (many diffs) n/a
2 ccsbBroad304_07565 pLX_304 0% 21.2% 19.5% V5 (many diffs) n/a
3 TRCN0000470808 ATATTGCACCGCAATAGTACTGAT pLX_317 27.9% 21.2% 19.5% V5 (many diffs) n/a
Download CSV