Transcript: Human XM_017005505.1

PREDICTED: Homo sapiens RNA binding motif protein 5 (RBM5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBM5 (10181)
Length:
3024
CDS:
810..2516

Additional Resources:

NCBI RefSeq record:
XM_017005505.1
NBCI Gene record:
RBM5 (10181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369315 ACTCGCAATACTACTATAATT pLKO_005 1516 CDS 100% 15.000 21.000 N RBM5 n/a
2 TRCN0000312601 CCGACAACAGGGCTCTATTAT pLKO_005 1488 CDS 100% 15.000 21.000 N RBM5 n/a
3 TRCN0000349734 ACTATGGTGAGCACGACTATA pLKO_005 371 5UTR 100% 13.200 18.480 N RBM5 n/a
4 TRCN0000312602 ACCATCACAGAGAGCGATATT pLKO_005 451 5UTR 100% 13.200 9.240 N RBM5 n/a
5 TRCN0000074874 CGCGTCTTTAGCTGTCAATAA pLKO.1 830 CDS 100% 13.200 9.240 N RBM5 n/a
6 TRCN0000369392 TGACCGTGATGAGCGTGAATC pLKO_005 198 5UTR 100% 10.800 7.560 N RBM5 n/a
7 TRCN0000054665 CCACAGTAACATTGGCAACAA pLKO.1 2294 CDS 100% 4.950 3.465 N Rbm5 n/a
8 TRCN0000287688 CCACAGTAACATTGGCAACAA pLKO_005 2294 CDS 100% 4.950 3.465 N Rbm5 n/a
9 TRCN0000074875 CCCAGACCTAAGTTTGAAGAT pLKO.1 661 5UTR 100% 4.950 3.465 N RBM5 n/a
10 TRCN0000327736 CCCAGACCTAAGTTTGAAGAT pLKO_005 661 5UTR 100% 4.950 3.465 N RBM5 n/a
11 TRCN0000074873 CCCTCCCACCTTAAAGAAGTT pLKO.1 2657 3UTR 100% 4.950 3.465 N RBM5 n/a
12 TRCN0000074877 GCTGGAGGATTGGAATCTGAT pLKO.1 1224 CDS 100% 4.950 3.465 N RBM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11465 pDONR223 100% 36.6% 36.6% None 0_1ins741;249T>C;898_1704del n/a
2 ccsbBroad304_11465 pLX_304 0% 36.6% 36.6% V5 0_1ins741;249T>C;898_1704del n/a
3 TRCN0000466364 TTAGGTTTCCAGCGTTGTGTGGTT pLX_317 18.9% 36.6% 36.6% V5 0_1ins741;249T>C;898_1704del n/a
Download CSV