Transcript: Human XM_017005525.1

PREDICTED: Homo sapiens stromal antigen 1 (STAG1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STAG1 (10274)
Length:
4660
CDS:
176..2641

Additional Resources:

NCBI RefSeq record:
XM_017005525.1
NBCI Gene record:
STAG1 (10274)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005525.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139370 CGTCGCTTTGCCCTTACATTT pLKO.1 1733 CDS 100% 13.200 18.480 N STAG1 n/a
2 TRCN0000447331 AGAGGATTTGTTGGTATTGAG pLKO_005 1141 CDS 100% 4.950 6.930 N Stag1 n/a
3 TRCN0000144014 CGATTCAATCATTCTGTGGAA pLKO.1 866 CDS 100% 2.640 3.696 N STAG1 n/a
4 TRCN0000109017 GCAGCTATCATAGAAGATGAT pLKO.1 2594 CDS 100% 0.495 0.396 N Stag1 n/a
5 TRCN0000144850 GCAGCTATCATAGAAGATGAT pLKO.1 2594 CDS 100% 0.495 0.396 N STAG1 n/a
6 TRCN0000140030 GCCCGAATGGAAACCTCATTA pLKO.1 240 CDS 100% 13.200 9.240 N STAG1 n/a
7 TRCN0000448553 ACTACATGAAGTATTACAATG pLKO_005 1539 CDS 100% 10.800 7.560 N Stag1 n/a
8 TRCN0000141458 CTTCAGCCTTTGGTGTTCAAT pLKO.1 1304 CDS 100% 5.625 3.938 N STAG1 n/a
9 TRCN0000142643 GTCTGGATAACACATGGCTAA pLKO.1 2142 CDS 100% 4.050 2.835 N STAG1 n/a
10 TRCN0000139493 CCAGAACAGATAGTCGTGCAA pLKO.1 1052 CDS 100% 2.640 1.848 N STAG1 n/a
11 TRCN0000343943 CCAGAACAGATAGTCGTGCAA pLKO_005 1052 CDS 100% 2.640 1.848 N STAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005525.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.