Transcript: Human XM_017005526.1

PREDICTED: Homo sapiens TRAF interacting protein (TRAIP), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRAIP (10293)
Length:
1752
CDS:
132..1244

Additional Resources:

NCBI RefSeq record:
XM_017005526.1
NBCI Gene record:
TRAIP (10293)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033740 CCCAGCATGGTTACTACGAAA pLKO.1 829 CDS 100% 4.950 3.465 N TRAIP n/a
2 TRCN0000291848 CCCAGCATGGTTACTACGAAA pLKO_005 829 CDS 100% 4.950 3.465 N TRAIP n/a
3 TRCN0000033739 CCGTGATGATATTGATCTCAA pLKO.1 764 CDS 100% 4.950 3.465 N TRAIP n/a
4 TRCN0000291847 CCGTGATGATATTGATCTCAA pLKO_005 764 CDS 100% 4.950 3.465 N TRAIP n/a
5 TRCN0000033742 GCCTACTGACACAGTCATGAT pLKO.1 1118 CDS 100% 4.950 3.465 N TRAIP n/a
6 TRCN0000033741 GCAGTGCCTAATTCAGTGGTT pLKO.1 224 CDS 100% 2.640 1.848 N TRAIP n/a
7 TRCN0000291849 GCAGTGCCTAATTCAGTGGTT pLKO_005 224 CDS 100% 2.640 1.848 N TRAIP n/a
8 TRCN0000033743 GCAGACAGTCTACTCTGAATT pLKO.1 542 CDS 100% 0.000 0.000 N TRAIP n/a
9 TRCN0000291846 GCAGACAGTCTACTCTGAATT pLKO_005 542 CDS 100% 0.000 0.000 N TRAIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02389 pDONR223 100% 78.8% 78.8% None 408_409ins297 n/a
2 ccsbBroad304_02389 pLX_304 0% 78.8% 78.8% V5 408_409ins297 n/a
3 TRCN0000471083 TTCCTTTTAAACTTCACAAGGGCC pLX_317 35.3% 78.8% 78.8% V5 408_409ins297 n/a
Download CSV