Transcript: Human XM_017005645.2

PREDICTED: Homo sapiens programmed cell death 10 (PDCD10), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDCD10 (11235)
Length:
2303
CDS:
1439..1888

Additional Resources:

NCBI RefSeq record:
XM_017005645.2
NBCI Gene record:
PDCD10 (11235)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140317 CGTAAGTGCCAACCGACTAAT pLKO.1 1822 CDS 100% 13.200 18.480 N PDCD10 n/a
2 TRCN0000247096 TAATGAGCTAGAACGAGTAAA pLKO_005 1211 5UTR 100% 13.200 18.480 N Pdcd10 n/a
3 TRCN0000145305 CAAGGATATAGCTAGTGCAAT pLKO.1 1642 CDS 100% 4.950 6.930 N PDCD10 n/a
4 TRCN0000144468 CCAACTTAATACTTCAGACCT pLKO.1 1851 CDS 100% 2.640 3.696 N PDCD10 n/a
5 TRCN0000435284 ACGGAGTCCCTTCTTCGTATG pLKO_005 1478 CDS 100% 6.000 4.800 N PDCD10 n/a
6 TRCN0000144228 CAGGATGTTGAATGGGATTAT pLKO.1 2002 3UTR 100% 13.200 9.240 N PDCD10 n/a
7 TRCN0000182961 CAGTCATGTATCCTGTGTTTA pLKO.1 1192 5UTR 100% 13.200 9.240 N Pdcd10 n/a
8 TRCN0000141584 CCAGGATGTTGAATGGGATTA pLKO.1 2001 3UTR 100% 10.800 7.560 N PDCD10 n/a
9 TRCN0000122250 CCTGTGTTTAATGAGCTAGAA pLKO.1 1203 5UTR 100% 4.950 3.465 N PDCD10 n/a
10 TRCN0000144821 GAATGGGATTATTGCCATCTT pLKO.1 2011 3UTR 100% 4.950 3.465 N PDCD10 n/a
11 TRCN0000122022 GCTGATGATGTAGAAGAGTAT pLKO.1 1502 CDS 100% 4.950 3.465 N PDCD10 n/a
12 TRCN0000142703 CCAGATGAGATCAATGACAGA pLKO.1 1601 CDS 100% 2.640 1.848 N PDCD10 n/a
13 TRCN0000141939 GATCAATGACAGAGTGAGGTT pLKO.1 1609 CDS 100% 2.640 1.848 N PDCD10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02654 pDONR223 100% 70.2% 70.2% None 0_1ins189 n/a
2 ccsbBroad304_02654 pLX_304 0% 70.2% 70.2% V5 0_1ins189 n/a
3 TRCN0000474286 GCCTCAAACTTCACCCGTCTTGTG pLX_317 62.3% 70.2% 70.2% V5 0_1ins189 n/a
Download CSV