Transcript: Human XM_017005684.2

PREDICTED: Homo sapiens polypeptide N-acetylgalactosaminyltransferase 15 (GALNT15), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GALNT15 (117248)
Length:
2577
CDS:
1406..2458

Additional Resources:

NCBI RefSeq record:
XM_017005684.2
NBCI Gene record:
GALNT15 (117248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005684.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035436 CCGAGTGGTATCTCCGGTGAT pLKO.1 1519 CDS 100% 1.350 1.890 N GALNT15 n/a
2 TRCN0000035435 TGTCGGACATTCCACTGGTTT pLKO.1 2048 CDS 100% 4.950 3.960 N GALNT15 n/a
3 TRCN0000425167 AGTCTGCTCTCAGCGAATATG pLKO_005 1320 5UTR 100% 13.200 9.240 N GALNT15 n/a
4 TRCN0000093982 TGGACAGACATTACTTCCAAA pLKO.1 1716 CDS 100% 4.950 3.465 N Galnt15 n/a
5 TRCN0000035438 CCTGAGGAACAGGGTTCGCAT pLKO.1 1903 CDS 100% 0.880 0.616 N GALNT15 n/a
6 TRCN0000035437 GCAGCCAAGGAGGCAGGATAA pLKO.1 936 5UTR 100% 3.600 2.160 N GALNT15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005684.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09447 pDONR223 100% 53.3% 51.3% None (many diffs) n/a
2 ccsbBroad304_09447 pLX_304 0% 53.3% 51.3% V5 (many diffs) n/a
3 TRCN0000467061 ACGAAATATTGCTAAGACTAAATC pLX_317 18.3% 53.3% 51.3% V5 (many diffs) n/a
Download CSV