Transcript: Human XM_017005945.2

PREDICTED: Homo sapiens MCF.2 cell line derived transforming sequence-like 2 (MCF2L2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCF2L2 (23101)
Length:
2274
CDS:
267..2177

Additional Resources:

NCBI RefSeq record:
XM_017005945.2
NBCI Gene record:
MCF2L2 (23101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425776 GATCACTCATGTCGATGAAAT pLKO_005 329 CDS 100% 13.200 9.240 N MCF2L2 n/a
2 TRCN0000047574 GCTCATCCAAAGCCACCATTA pLKO.1 1424 CDS 100% 10.800 7.560 N MCF2L2 n/a
3 TRCN0000047576 CCAGATGAAGACTTCCTGAAT pLKO.1 492 CDS 100% 4.950 3.465 N MCF2L2 n/a
4 TRCN0000047573 CCAGGAAACTTACAGCTCATA pLKO.1 642 CDS 100% 4.950 3.465 N MCF2L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11675 pDONR223 100% 87.9% 87.2% None (many diffs) n/a
2 ccsbBroad304_11675 pLX_304 0% 87.9% 87.2% V5 (many diffs) n/a
3 TRCN0000476383 AATCGAACAGTCTTACTCGTTTCG pLX_317 18.7% 87.9% 87.2% V5 (many diffs) n/a
Download CSV