Transcript: Human XM_017006021.1

PREDICTED: Homo sapiens nucleoporin 210 (NUP210), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUP210 (23225)
Length:
4264
CDS:
94..2949

Additional Resources:

NCBI RefSeq record:
XM_017006021.1
NBCI Gene record:
NUP210 (23225)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152698 GCGCCTATCAGTACACAATAA pLKO.1 1502 CDS 100% 13.200 18.480 N NUP210 n/a
2 TRCN0000151745 CTGACAACATCCGAATTGAAA pLKO.1 1241 CDS 100% 5.625 7.875 N NUP210 n/a
3 TRCN0000152851 GAGGCTGTCTACAAGAATGTA pLKO.1 763 CDS 100% 5.625 3.938 N NUP210 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11700 pDONR223 100% 98.1% 98% None (many diffs) n/a
2 ccsbBroad304_11700 pLX_304 0% 98.1% 98% V5 (many diffs) n/a
3 TRCN0000479653 GTGGTCTTTTGAGGACCATACCCA pLX_317 10.6% 98.1% 98% V5 (many diffs) n/a
Download CSV