Transcript: Human XM_017006057.1

PREDICTED: Homo sapiens zinc finger and BTB domain containing 38 (ZBTB38), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZBTB38 (253461)
Length:
7282
CDS:
763..4350

Additional Resources:

NCBI RefSeq record:
XM_017006057.1
NBCI Gene record:
ZBTB38 (253461)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006057.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237976 GTATCCAACTTAGAGGTTAAT pLKO_005 1621 CDS 100% 13.200 18.480 N ZBTB38 n/a
2 TRCN0000237975 CCTAGTGTCTATCCGTATAAA pLKO_005 2434 CDS 100% 15.000 12.000 N ZBTB38 n/a
3 TRCN0000237973 ATCACGAGCAGAGGCATATTC pLKO_005 4094 CDS 100% 13.200 9.240 N ZBTB38 n/a
4 TRCN0000237974 ATACGGGAGAAAGACGATATC pLKO_005 2291 CDS 100% 10.800 7.560 N ZBTB38 n/a
5 TRCN0000096638 GCAAACGTAGTTATGTGACTT pLKO.1 2156 CDS 100% 4.950 3.960 N Zbtb38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006057.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13450 pDONR223 100% 27.2% 27.2% None 1_2607del n/a
2 ccsbBroad304_13450 pLX_304 0% 27.2% 27.2% V5 1_2607del n/a
3 TRCN0000468651 CTTTACCGCTTATCACGTGCTTCA pLX_317 47% 27.2% 27.2% V5 1_2607del n/a
Download CSV